Sorry, there was a problem loading sequence from server. Please try again and contact us if the problem persists.

Homo sapiens (human) hsa-miR-340-5p URS0000007FBA_9606

Caution, this is an AI generated summary based on literature. This may have errors, see here for more. Please share your feedback with us.

hsa-mir-340: Hsa-mir-340 is a microRNA that has been found to be downregulated in the low bone mineral density (BMD) group and is correlated with the expression level of its target gene PDPK1 [PMC4577125]. In prostate cancer cell lysates, hsa-mir-340 was used in a DNA pull-down assay to target and bind with streptavidin-containing magnetic beads [PMC7884413]. However, the reduced expression of hsa-mir-340 did not significantly improve cisplatin cytotoxicity, while increased expression of hsa-miR-302b enhanced cisplatin cytotoxicity [PMC3590172]. In dilated cardiomyopathy (DCM) samples, hsa-mir-340 was found to be significantly differentially regulated compared to non-failing control samples [PMC4118176]. Additionally, hsa-mir-340 was found to be upregulated in DCM samples along with other miRNAs such as hsa-miR-19b and hsa-miR-302 [PMC4118176]. Higher expression of hsa-mir-340 was associated with shorter overall survival time in endometrial cancer patients [PMC9200351]. In the context of COVID-19 interaction, hsa-mir-340 was among the significant miRNAs identified in the TF–miRNA network analysis [PMC9429819]. Hsa-mir-340 has also been associated with mitochondria in HEK293 cells along with other miRNAs such as hsa-miR-25 and hsa-miR-423-5p [PMC3439422]. Complementary sequences were detected between COMMD6 and hsa-mir-340 as well as between lncRNA TEX41 and hsa-mir 340 [PMC6889128][PMC6889128].

Genome locations

Gene Ontology annotations

Localisation

Sequence

Sequence features are shown above as colored rectangles. Zoom in and click to view details, or Reset

Search for similar sequences
UUAUAAAGCAAUGAGACUGAUU

Taxonomic tree

View annotations in different species by clicking on species names.

Scroll around to explore the entire tree. Click tree nodes to collapse or expand them. Hover over taxon names to display additional information.

This sequence is found in 24 other species

  1. Bos taurus Bta-Mir-340_5p (mature (guide))
  2. Callithrix jacchus cja-miR-340
  3. Canis lupus familiaris (dog) cfa-miR-340
  4. Capra hircus (goat) chi-miR-340-5p
  5. Cavia porcellus cpo-miR-340-5p
  6. Cervus elaphus cel-miR-340
  7. Cricetulus griseus (Chinese hamster) cgr-miR-340-5p
  8. Dasypus novemcinctus (nine-banded armadillo) dno-miR-340-5p
  9. Daubentonia madagascariensis dma-miR-340
  10. Echinops telfairi (small Madagascar hedgehog) Ete-Mir-340_5p (mature (guide))
  11. Equus caballus eca-miR-340-5p
  12. Macaca mulatta mml-miR-340-5p
  13. Microcebus murinus mmr-miR-340
  14. Mus musculus (house mouse) mmu-miR-340-5p
  15. Nomascus leucogenys nle-miR-340
  16. Oryctolagus cuniculus (rabbit) ocu-miR-340-5p
  17. Otolemur garnettii (small-eared galago) oga-miR-340
  18. Pan paniscus ppa-miR-340
  19. Pan troglodytes ptr-miR-340
  20. Papio hamadryas (hamadryas baboon) pha-miR-340
  21. Pongo pygmaeus (Bornean orangutan) ppy-miR-340
  22. Pteropus alecto pal-miR-340-5p
  23. Rattus norvegicus rno-miR-340-5p
  24. Sus scrofa (pig) ssc-miR-340
Publications