Sorry, there was a problem loading sequence from server. Please try again and contact us if the problem persists.

Microcebus murinus (gray mouse lemur) mmr-miR-340 URS0000007FBA_30608

Genome locations

Gene Ontology annotations

Sequence

Sequence features are shown above as colored rectangles. Zoom in and click to view details, or Reset

Search for similar sequences
UUAUAAAGCAAUGAGACUGAUU

Taxonomic tree

View annotations in different species by clicking on species names.

Scroll around to explore the entire tree. Click tree nodes to collapse or expand them. Hover over taxon names to display additional information.

This sequence is found in 24 other species

  1. Bos taurus Bta-Mir-340_5p (mature (guide))
  2. Callithrix jacchus (white-tufted-ear marmoset) cja-miR-340
  3. Canis lupus familiaris (dog) cfa-miR-340
  4. Capra hircus chi-miR-340-5p
  5. Cavia porcellus cpo-miR-340-5p
  6. Cervus elaphus cel-miR-340
  7. Cricetulus griseus cgr-miR-340-5p
  8. Dasypus novemcinctus (nine-banded armadillo) dno-miR-340-5p
  9. Daubentonia madagascariensis (aye-aye) dma-miR-340
  10. Echinops telfairi (small Madagascar hedgehog) Ete-Mir-340_5p (mature (guide))
  11. Equus caballus (horse) eca-miR-340-5p
  12. Homo sapiens hsa-miR-340-5p
  13. Macaca mulatta mml-miR-340-5p
  14. Mus musculus (house mouse) mmu-miR-340-5p
  15. Nomascus leucogenys nle-miR-340
  16. Oryctolagus cuniculus ocu-miR-340-5p
  17. Otolemur garnettii oga-miR-340
  18. Pan paniscus ppa-miR-340
  19. Pan troglodytes ptr-miR-340
  20. Papio hamadryas (hamadryas baboon) pha-miR-340
  21. Pongo pygmaeus ppy-miR-340
  22. Pteropus alecto pal-miR-340-5p
  23. Rattus norvegicus (Norway rat) rno-miR-340-5p
  24. Sus scrofa ssc-miR-340