Sorry, there was a problem loading sequence from server. Please try again and contact us if the problem persists.

Cynara cardunculus var. scolymus cca-miR397h URS0000007DC3_59895

Automated summary: This miRNA sequence is 21 nucleotides long and is found in Cynara cardunculus var. scolymus. Annotated by 1 database (ENA). Cynara cardunculus var. scolymus cca-miR397h sequence is a product of miR397, miR397h, cca-miR397h genes. Found in the Cynara cardunculus var. scolymus reference genome.

Genome locations

Sorry, there was a problem loading genome locations from server. Please try again and contact us if the problem persists.

This sequence is found in {{ locations.length }} genome :

Go to location Chromosome Start End Strand Ensembl UCSC Sequence identity
Loading genome locations...
Failed to load data from server
No genome locations known
loading browser
  • Can't view - strange chromosome name
  • {{ location.chromosome }} {{ location.start | number }} {{ location.end | number }} {{ location.strand == "1" ? "forward" : "reverse" }} {{ location.ensembl_division.name.replace('EnsemblVertebrates', 'Ensembl') }} UCSC 100% {{ location.identity * 100 | number:0 }}%

    No genome locations found for this sequence. Learn more →

    Gene Ontology annotations

    Sequence

    Sequence features are shown above as colored rectangles. Zoom in and click to view details, or Reset

    Search for similar sequences
    AUUGAGUGCAGCGUUGAUGAA

    Taxonomic tree

    View annotations in different species by clicking on species names.

    Scroll around to explore the entire tree. Click tree nodes to collapse or expand them. Hover over taxon names to display additional information.

    This sequence is found in 2 other species

    1. Brachypodium distachyon (stiff brome) bdi-miR397b-5p
    2. Linum usitatissimum lus-miR397a