Sorry, there was a problem loading sequence from server. Please try again and contact us if the problem persists.
Ursus thibetanus thibetanus (Asiatic black bear) Y RNA (ENSUTTG00000008294.1) secondary structure diagram

Ursus thibetanus thibetanus (Asiatic black bear) Y RNA (ENSUTTG00000008294.1) URS0000007D24_441215

Genome locations

Gene Ontology annotations

Sequence

Sequence features are shown above as colored rectangles. Zoom in and click to view details, or Reset

Search for similar sequences
GGCUGGUCCGAUGGUAGUGGGUUAUCAGAACUUAUUAACAUUAGUGUCACUAAAGUUGGUAUACAACCCCCCACUGCUAAAUUUGACUGGCUUUUU

Taxonomic tree

View annotations in different species by clicking on species names.

Scroll around to explore the entire tree. Click tree nodes to collapse or expand them. Hover over taxon names to display additional information.

This sequence is found in 27 other species

  1. Ailuropoda melanoleuca Y RNA (ENSAMEG00000030474.1)
  2. Callithrix jacchus Y RNA (ENSCJAG00000082905.1)
  3. Cebus imitator Y RNA (ENSCCAG00000000313.1)
  4. Cercocebus atys (Sooty mangabey) Y RNA (ENSCATG00000007100.1)
  5. Chlorocebus sabaeus (African green monkey) Y RNA (ENSCSAG00000025277.1)
  6. Colobus angolensis palliatus (Angola colobus) Y RNA (ENSCANG00000016938.1)
  7. Dasypus novemcinctus (nine-banded armadillo) Y RNA (ENSDNOG00000028615.1)
  8. Equus asinus asinus Y RNA (ENSEASG00005009022.1)
  9. Equus asinus Y RNA (ENSEASG00005009022.2)
  10. Equus caballus Y RNA (ENSECAG00000025921.2)
  11. Fukomys damarensis Y RNA (ENSFDAG00000003734.1)
  12. Gorilla gorilla gorilla Y RNA (ENSGGOG00000035071.2)
  13. Homo sapiens RNA, Ro60-associated Y4 (RNY4)
  14. Macaca fascicularis (Crab-eating macaque) Y RNA (ENSMFAG00000034878.2)
  15. Macaca mulatta Y RNA (ENSMMUG00000028452.3, ENSMMUG00000059522.1)
  16. Macaca nemestrina Y RNA (ENSMNEG00000024804.1)
  17. Mustela putorius furo Y RNA (ENSMPUG00000021160.1)
  18. Neogale vison Y RNA (ENSNVIG00000003927.1)
  19. Oryctolagus cuniculus Y RNA (ENSOCUG00000018615.1)
  20. Pan paniscus Y RNA (ENSPPAG00000016316.1)
  21. Pan troglodytes Y RNA (ENSPTRG00000038023.2, ENSPTRG00000049197.1)
  22. Papio anubis Y RNA (ENSPANG00000017873.3)
  23. Piliocolobus tephrosceles Y RNA (ENSPTEG00000030638.1)
  24. Rhinopithecus bieti (Black snub-nosed monkey) Y RNA (ENSRBIG00000024485.1)
  25. Theropithecus gelada Y RNA (ENSTGEG00000002319.1)
  26. Ursus americanus Y RNA (ENSUAMG00000015060.1)
  27. Ursus maritimus Y RNA (ENSUMAG00000011458.1)
  28. Zalophus californianus (california sea lion) Y RNA (ENSZCAG00015016009.1)
2D structure Publications