v24

Sorry, there was a problem loading sequence from server. Please try again and contact us if the problem persists.
Rickettsia africae ESF-5 5S ribosomal RNA secondary structure diagram

Rickettsia africae ESF-5 5S ribosomal RNA URS000000784F_347255

Genome locations

Gene Ontology annotations

Sequence

Sequence features are shown above as colored rectangles. Zoom in and click to view details, or Reset

Search for similar sequences 
AGCUUGGUGGUUAUAGCAUGAGUGAAACACACGAUCCCAUCCCGAACUCGAAUGUGAAACCUCAUAGCGCUAAUGGUACUAUGUCAUAAGGCAUGGGAGAGUAAGUCGCUGCCAAGCUU

Taxonomic tree

View annotations in different species by clicking on species names.

Scroll around to explore the entire tree. Click tree nodes to collapse or expand them. Hover over taxon names to display additional information.

This sequence is found in 7 other species

  1. Rickettsia africae 5S rRNA
  2. Rickettsia conorii 5S rRNA
  3. Rickettsia conorii str. Malish 7 5S ribosomal RNA
  4. Rickettsia rickettsii 5S rRNA
  5. Rickettsia rickettsii str. Iowa 5S ribosomal RNA
  6. Rickettsia rickettsii str. 'Sheila Smith' 5S ribosomal RNA
  7. Rickettsia sibirica 5S rRNA
 2D structure