Sorry, there was a problem loading sequence from server. Please try again and contact us if the problem persists.
Rickettsia rickettsii str. 'Sheila Smith' 5S ribosomal RNA secondary structure diagram

Rickettsia rickettsii str. 'Sheila Smith' 5S ribosomal RNA URS000000784F_392021

Genome locations

Gene Ontology annotations

Sequence

Sequence features are shown above as colored rectangles. Zoom in and click to view details, or Reset

Search for similar sequences
AGCUUGGUGGUUAUAGCAUGAGUGAAACACACGAUCCCAUCCCGAACUCGAAUGUGAAACCUCAUAGCGCUAAUGGUACUAUGUCAUAAGGCAUGGGAGAGUAAGUCGCUGCCAAGCUU

Taxonomic tree

View annotations in different species by clicking on species names.

Scroll around to explore the entire tree. Click tree nodes to collapse or expand them. Hover over taxon names to display additional information.

This sequence is found in 7 other species

  1. Rickettsia africae 5S rRNA
  2. Rickettsia africae ESF-5 5S ribosomal RNA
  3. Rickettsia conorii 5S rRNA
  4. Rickettsia conorii str. Malish 7 5S ribosomal RNA
  5. Rickettsia rickettsii 5S rRNA
  6. Rickettsia rickettsii str. Iowa 5S ribosomal RNA
  7. Rickettsia sibirica 5S rRNA
2D structure