Sorry, there was a problem loading sequence from server. Please try again and contact us if the problem persists.
Homo sapiens (human) microRNA hsa-mir-127 precursor secondary structure diagram

Homo sapiens (human) microRNA hsa-mir-127 precursor URS0000007340_9606

Automated summary: This pre miRNA sequence is 97 nucleotides long and is found in Homo sapiens. Annotated by 8 databases (GeneCards, ENA, RefSeq, Rfam, MalaCards, HGNC, miRBase, Ensembl). Described in 54 papers. Has a conserved secondary structure or a structured region. Matches 1 Rfam family (mir-127, RF00676). Homo sapiens (human) microRNA hsa-mir-127 precursor sequence is a product of mir-127 precursor, hsa-mir-127 precursor, ENSG00000207608.3, 127, mir-127 precurso, MIR127, mir-127 genes. Found in the human reference genome.

Genome locations

Sorry, there was a problem loading genome locations from server. Please try again and contact us if the problem persists.

This sequence is found in {{ locations.length }} genome :

Go to location Chromosome Start End Strand Ensembl UCSC Sequence identity
Loading genome locations...
Failed to load data from server
No genome locations known
loading browser
  • Can't view - strange chromosome name
  • {{ location.chromosome }} {{ location.start | number }} {{ location.end | number }} {{ location.strand == "1" ? "forward" : "reverse" }} {{ location.ensembl_division.name.replace('EnsemblVertebrates', 'Ensembl') }} UCSC 100% {{ location.identity * 100 | number:0 }}%

    No genome locations found for this sequence. Learn more →

    Gene Ontology annotations

    Sequence

    Sequence features are shown above as colored rectangles. Zoom in and click to view details, or Reset

    UGUGAUCACUGUCUCCAGCCUGCUGAAGCUCAGAGGGCUCUGAUUCAGAAAGAUCAUCGGAUCCGUCUGAGCUUGGCUGGUCGGAAGUCUCAUCAUC

    Taxonomic tree

    View annotations in different species by clicking on species names.

    Scroll around to explore the entire tree. Click tree nodes to collapse or expand them. Hover over taxon names to display additional information.

    This sequence is found in 97 other species

    1. Ailuropoda melanoleuca microRNA mir-127
    2. Aotus nancymaae (Ma's night monkey) miRNA (ENSANAG00000010944.1)
    3. Ateles geoffroyi microRNA age-mir-127 precursor
    4. Callithrix jacchus miRNA MIR127 (ENSCJAG00000026365.3)
    5. Canis lupus familiaris microRNA mir-127
    6. Carlito syrichta miRNA (ENSTSYG00000021301.2)
    7. Cavia porcellus (Domestic guinea pig) microRNA mir-127
    8. Chlorocebus sabaeus microRNA mir-127
    9. Colobus angolensis palliatus miRNA (ENSCANG00000003328.1)
    10. Dipodomys ordii microRNA mir-127
    11. Equus caballus (horse) microRNA mir-127
    12. Felis catus microRNA mir-127
    13. Fukomys damarensis (Damara mole-rat) microRNA mir-127
    14. Gorilla gorilla gorilla microRNA 127 (ENSGGOG00000031077.2)
    15. Gorilla gorilla microRNA mir-127
    16. Heterocephalus glaber microRNA mir-127
    17. Lagothrix lagotricha microRNA lla-mir-127 precursor
    18. Marmota monax (woodchuck) non-coding RNA
    19. Mustela putorius furo microRNA 127 (ENSMPUG00000023457.1)
    20. Myotis brandtii microRNA mir-127
    21. Myotis davidii microRNA mir-127
    22. Myotis lucifugus microRNA 127 (ENSMLUG00000017857.1)
    23. Nomascus leucogenys miRNA (ENSNLEG00000021779.2)
    24. Pan paniscus (bonobo) miRNA (ENSPPAG00000013220.1)
    25. Panthera pardus microRNA 127 (ENSPPRG00000013652.1)
    26. Panthera tigris altaica (Tiger) microRNA 127 (ENSPTIG00000003174.1)
    27. Pan troglodytes (chimpanzee) microRNA ptr-mir-127 precursor
    28. Peromyscus maniculatus bairdii (Northern American deer mouse) microRNA 127 (ENSPEMG00000006052.2)
    29. Pongo abelii (Sumatran orangutan) microRNA mir-127
    30. Pongo pygmaeus microRNA ppy-mir-127 precursor
    31. Pteropus alecto (black flying fox) microRNA mir-127
    32. Pteropus vampyrus microRNA 127 (ENSPVAG00000024956.1)
    33. Rhinolophus ferrumequinum (greater horseshoe bat) microRNA 127 (ENSRFEG00010005252.1)
    34. Rhinopithecus bieti (Black snub-nosed monkey) miRNA (ENSRBIG00000018257.1)
    35. Rhinopithecus roxellana miRNA (ENSRROG00000027377.1)
    36. Saguinus labiatus microRNA sla-mir-127 precursor
    37. Saimiri boliviensis boliviensis (Bolivian squirrel monkey) miRNA (ENSSBOG00000003979.1)
    38. Ictidomys tridecemlineatus microRNA mir-127
    39. Suricata suricatta (meerkat) microRNA 127 (ENSSSUG00005012097.1)
    2D structure Publications New