Sorry, there was a problem loading sequence from server. Please try again and contact us if the problem persists.
Homo sapiens (human) microRNA hsa-mir-127 precursor secondary structure diagram

Homo sapiens (human) microRNA hsa-mir-127 precursor URS0000007340_9606

  • 97 nucleotides
  • 9 databases (ENA, Ensembl, Ensembl/GENCODE, GeneCards, HGNC, MalaCards, miRBase, RefSeq, Rfam)
  • Found in 57 species

Automated summary: This pre miRNA sequence is 97 nucleotides long and is found in Homo sapiens. Annotated by 9 databases (RefSeq, ENA, Rfam, Ensembl/GENCODE, HGNC, Ensembl, MalaCards, miRBase, GeneCards). Described in 49 papers. Has a conserved secondary structure or a structured region. Matches 1 Rfam family (mir-127, RF00676). Homo sapiens (human) microRNA hsa-mir-127 precursor sequence is a product of ENSG00000207608.3, mir-127 precurso, mir-127, MIR127, mir-127 precursor, hsa-mir-127 precursor, 127 genes. Found in the human reference genome.

Genome locations

Sorry, there was a problem loading genome locations from server. Please try again and contact us if the problem persists.

This sequence is found in {{ locations.length }} genome :

Go to location Chromosome Start End Strand Ensembl UCSC Sequence identity
Loading genome locations...
Failed to load data from server
No genome locations known
loading browser
  • Can't view - strange chromosome name
  • {{ location.chromosome }} {{ location.start | number }} {{ location.end | number }} {{ location.strand == "1" ? "forward" : "reverse" }} {{ location.ensembl_division.name.replace('EnsemblVertebrates', 'Ensembl') }} UCSC 100% {{ location.identity * 100 | number:0 }}%

    No genome locations found for this sequence. Learn more →

    Gene Ontology annotations

    Sequence

    Sequence features are shown above as colored rectangles. Zoom in and click to view details, or Reset

    UGUGAUCACUGUCUCCAGCCUGCUGAAGCUCAGAGGGCUCUGAUUCAGAAAGAUCAUCGGAUCCGUCUGAGCUUGGCUGGUCGGAAGUCUCAUCAUC

    Taxonomic tree

    View annotations in different species by clicking on species names.

    Scroll around to explore the entire tree. Click tree nodes to collapse or expand them. Hover over taxon names to display additional information.

    This sequence is found in 56 other species

    1. Ailuropoda melanoleuca microRNA mir-127
    2. Aotus nancymaae miRNA (ENSANAG00000010944.1)
    3. Ateles geoffroyi (black-handed spider monkey) microRNA age-mir-127 precursor
    4. Callithrix jacchus miRNA (ENSCJAG00000026365.2)
    5. Canis lupus familiaris microRNA mir-127
    6. Carlito syrichta miRNA (ENSTSYG00000021301.2)
    7. Cavia porcellus microRNA mir-127
    8. Chlorocebus sabaeus microRNA mir-127
    9. Colobus angolensis palliatus microRNA 127 (ENSCANG00000003328.1)
    10. Dipodomys ordii microRNA mir-127
    11. Equus caballus microRNA mir-127
    12. Felis catus microRNA mir-127
    13. Fukomys damarensis microRNA mir-127
    14. Gorilla gorilla gorilla microRNA 127 (ENSGGOG00000031077.2)
    15. Heterocephalus glaber microRNA mir-127
    16. Lagothrix lagotricha microRNA lla-mir-127 precursor
    17. Marmota monax non-coding RNA
    18. Mustela putorius furo (Domestic ferret) microRNA 127 (ENSMPUG00000023457.1)
    19. Myotis brandtii microRNA mir-127
    20. Myotis davidii microRNA mir-127
    21. Myotis lucifugus microRNA 127 (ENSMLUG00000017857.1)
    22. Nomascus leucogenys miRNA (ENSNLEG00000021779.2)
    23. Pan paniscus miRNA (ENSPPAG00000013220.1)
    24. Panthera pardus microRNA 127 (ENSPPRG00000013652.1)
    25. Panthera tigris altaica (Tiger) microRNA 127 (ENSPTIG00000003174.1)
    26. Pan troglodytes (chimpanzee) microRNA ptr-mir-127 precursor
    27. Peromyscus maniculatus bairdii (Northern American deer mouse) microRNA 127 (ENSPEMG00000006052.2)
    28. Pongo abelii microRNA 127 (ENSPPYG00000021944.1)
    29. Pongo pygmaeus microRNA ppy-mir-127 precursor
    30. Pteropus alecto microRNA mir-127
    31. Pteropus vampyrus microRNA 127 (ENSPVAG00000024956.1)
    32. Rhinolophus ferrumequinum microRNA 127 (ENSRFEG00010005252.1)
    33. Rhinopithecus bieti (Black snub-nosed monkey) miRNA (ENSRBIG00000018257.1)
    34. Rhinopithecus roxellana miRNA (ENSRROG00000027377.1)
    35. Saguinus labiatus microRNA sla-mir-127 precursor
    36. Saimiri boliviensis boliviensis miRNA (ENSSBOG00000003979.1)
    37. Ictidomys tridecemlineatus microRNA mir-127
    38. Suricata suricatta (meerkat) microRNA 127 (ENSSSUG00005012097.1)
    2D structure New