Sorry, there was a problem loading sequence from server. Please try again and contact us if the problem persists.
Aotus nancymaae (Ma's night monkey) miRNA (ENSANAG00000010944.1) secondary structure diagram

Aotus nancymaae (Ma's night monkey) miRNA (ENSANAG00000010944.1) URS0000007340_37293

Genome locations

Sorry, there was a problem loading genome locations from server. Please try again and contact us if the problem persists.

This sequence is found in {{ locations.length }} genome :

Go to location Chromosome Start End Strand Ensembl UCSC Sequence identity
Loading genome locations...
Failed to load data from server
No genome locations known
loading browser
  • Can't view - strange chromosome name
  • {{ location.chromosome }} {{ location.start | number }} {{ location.end | number }} {{ location.strand == "1" ? "forward" : "reverse" }} {{ location.ensembl_division.name.replace('EnsemblVertebrates', 'Ensembl') }} UCSC 100% {{ location.identity * 100 | number:0 }}%

    No genome locations found for this sequence. Learn more →

    Gene Ontology annotations

    Sequence

    Sequence features are shown above as colored rectangles. Zoom in and click to view details, or Reset

    Search for similar sequences
    UGUGAUCACUGUCUCCAGCCUGCUGAAGCUCAGAGGGCUCUGAUUCAGAAAGAUCAUCGGAUCCGUCUGAGCUUGGCUGGUCGGAAGUCUCAUCAUC

    Taxonomic tree

    View annotations in different species by clicking on species names.

    Scroll around to explore the entire tree. Click tree nodes to collapse or expand them. Hover over taxon names to display additional information.

    This sequence is found in 39 other species

    1. Ailuropoda melanoleuca microRNA mir-127
    2. Ateles geoffroyi microRNA age-mir-127 precursor
    3. Callithrix jacchus miRNA (ENSCJAG00000026365.3)
    4. Canis lupus familiaris (dog) microRNA mir-127
    5. Carlito syrichta (Philippine tarsier) miRNA (ENSTSYG00000021301.2)
    6. Cavia porcellus (Domestic guinea pig) microRNA mir-127
    7. Chlorocebus sabaeus microRNA mir-127
    8. Colobus angolensis palliatus miRNA (ENSCANG00000003328.1)
    9. Dipodomys ordii microRNA mir-127
    10. Equus caballus microRNA mir-127
    11. Felis catus (domestic cat) microRNA mir-127
    12. Fukomys damarensis (Damara mole-rat) microRNA mir-127
    13. Gorilla gorilla gorilla microRNA 127 (ENSGGOG00000031077.2)
    14. Gorilla gorilla (western gorilla) microRNA mir-127
    15. Heterocephalus glaber microRNA mir-127
    16. Homo sapiens microRNA hsa-mir-127 precursor
    17. Lagothrix lagotricha microRNA lla-mir-127 precursor
    18. Marmota monax (woodchuck) non-coding RNA
    19. Mustela putorius furo (Domestic ferret) microRNA 127 (ENSMPUG00000023457.1)
    20. Myotis brandtii microRNA mir-127
    21. Myotis davidii microRNA mir-127
    22. Myotis lucifugus microRNA 127 (ENSMLUG00000017857.1)
    23. Nomascus leucogenys miRNA MIR127 (ENSNLEG00000021779.2)
    24. Pan paniscus miRNA MIR127 (ENSPPAG00000013220.1)
    25. Panthera pardus miRNA (ENSPPRG00000013652.1)
    26. Panthera tigris altaica (Tiger) miRNA (ENSPTIG00000003174.1)
    27. Pan troglodytes microRNA ptr-mir-127 precursor
    28. Peromyscus maniculatus bairdii microRNA 127 (ENSPEMG00000006052.2)
    29. Pongo abelii microRNA mir-127
    30. Pongo pygmaeus microRNA ppy-mir-127 precursor
    31. Pteropus alecto (black flying fox) microRNA mir-127
    32. Pteropus vampyrus (large flying fox) microRNA 127 (ENSPVAG00000024956.1)
    33. Rhinolophus ferrumequinum microRNA 127 (ENSRFEG00010005252.1)
    34. Rhinopithecus bieti (Black snub-nosed monkey) miRNA (ENSRBIG00000018257.1)
    35. Rhinopithecus roxellana miRNA (ENSRROG00000027377.1)
    36. Saguinus labiatus microRNA sla-mir-127 precursor
    37. Saimiri boliviensis boliviensis (Bolivian squirrel monkey) miRNA (ENSSBOG00000003979.1)
    38. Ictidomys tridecemlineatus microRNA mir-127
    39. Suricata suricatta microRNA 127 (ENSSSUG00005012097.1)
    40. Cebus imitator None
    2D structure