Sorry, there was a problem loading sequence from server. Please try again and contact us if the problem persists.
Saccharomyces cerevisiae YJM969 tRNA-Ser secondary structure diagram

Saccharomyces cerevisiae YJM969 tRNA-Ser URS00000064B1_1294323

Automated summary: This tRNA sequence is 86 nucleotides long and is found in Saccharomyces cerevisiae YJM969. Annotated by 1 database (ENA). Described in 1 paper. Has a conserved secondary structure or a structured region. Matches 1 Rfam family (tRNA, RF00005).

Genome locations

Sorry, there was a problem loading genome locations from server. Please try again and contact us if the problem persists.

This sequence is found in {{ locations.length }} genome :

Go to location Chromosome Start End Strand Ensembl UCSC Sequence identity
Loading genome locations...
Failed to load data from server
No genome locations known
loading browser
  • Can't view - strange chromosome name
  • {{ location.chromosome }} {{ location.start | number }} {{ location.end | number }} {{ location.strand == "1" ? "forward" : "reverse" }} {{ location.ensembl_division.name.replace('EnsemblVertebrates', 'Ensembl') }} UCSC 100% {{ location.identity * 100 | number:0 }}%

    No genome locations found for this sequence. Learn more →

    Gene Ontology annotations

    Sequence

    Sequence features are shown above as colored rectangles. Zoom in and click to view details, or Reset

    GGAAAAUUAACUAUAGGUAAAGUGGAUUAUUUGCUAAGUAAUUGAAUUGUAAAUUCUUAUGAGUUCGAAUCUCAUAUUUUCCGUAU

    Taxonomic tree

    View annotations in different species by clicking on species names.

    Scroll around to explore the entire tree. Click tree nodes to collapse or expand them. Hover over taxon names to display additional information.

    This sequence is found in 99 other species

    1. Saccharomyces cerevisiae (baker's yeast) tRNA-Ser
    2. Saccharomyces cerevisiae Kyokai no. 7 tRNA-Ser
    3. Saccharomyces cerevisiae PE-2 tRNA-Ser
    4. Saccharomyces cerevisiae S288C tRNA-Ser
    5. Saccharomyces cerevisiae x Saccharomyces paradoxus tRNA-Ser
    6. Saccharomyces cerevisiae YJM1078 tRNA-Ser
    7. Saccharomyces cerevisiae YJM1083 tRNA-Ser
    8. Saccharomyces cerevisiae YJM1129 tRNA-Ser
    9. Saccharomyces cerevisiae YJM1133 tRNA-Ser
    10. Saccharomyces cerevisiae YJM1190 tRNA-Ser
    11. Saccharomyces cerevisiae YJM1199 tRNA-Ser
    12. Saccharomyces cerevisiae YJM1202 tRNA-Ser
    13. Saccharomyces cerevisiae YJM1208 tRNA-Ser
    14. Saccharomyces cerevisiae YJM1242 tRNA-Ser
    15. Saccharomyces cerevisiae YJM1244 tRNA-Ser
    16. Saccharomyces cerevisiae YJM1248 tRNA-Ser
    17. Saccharomyces cerevisiae YJM1250 tRNA-Ser
    18. Saccharomyces cerevisiae YJM1252 tRNA-Ser
    19. Saccharomyces cerevisiae YJM1273 tRNA-Ser
    20. Saccharomyces cerevisiae YJM1304 tRNA-Ser
    21. Saccharomyces cerevisiae YJM1307 tRNA-Ser
    22. Saccharomyces cerevisiae YJM1311 tRNA-Ser
    23. Saccharomyces cerevisiae YJM1326 tRNA-Ser
    24. Saccharomyces cerevisiae YJM1332 tRNA-Ser
    25. Saccharomyces cerevisiae YJM1336 tRNA-Ser
    26. Saccharomyces cerevisiae YJM1338 tRNA-Ser
    27. Saccharomyces cerevisiae YJM1341 tRNA-Ser
    28. Saccharomyces cerevisiae YJM1342 tRNA-Ser
    29. Saccharomyces cerevisiae YJM1355 tRNA-Ser
    30. Saccharomyces cerevisiae YJM1356 tRNA-Ser
    31. Saccharomyces cerevisiae YJM1381 tRNA-Ser
    32. Saccharomyces cerevisiae YJM1383 tRNA-Ser
    33. Saccharomyces cerevisiae YJM1385 tRNA-Ser
    34. Saccharomyces cerevisiae YJM1386 tRNA-Ser
    35. Saccharomyces cerevisiae YJM1387 tRNA-Ser
    36. Saccharomyces cerevisiae YJM1388 tRNA-Ser
    37. Saccharomyces cerevisiae YJM1389 tRNA-Ser
    38. Saccharomyces cerevisiae YJM1399 tRNA-Ser
    39. Saccharomyces cerevisiae YJM1400 tRNA-Ser
    40. Saccharomyces cerevisiae YJM1401 tRNA-Ser
    41. Saccharomyces cerevisiae YJM1402 tRNA-Ser
    42. Saccharomyces cerevisiae YJM1415 tRNA-Ser
    43. Saccharomyces cerevisiae YJM1418 tRNA-Ser
    44. Saccharomyces cerevisiae YJM1419 tRNA-Ser
    45. Saccharomyces cerevisiae YJM1433 tRNA-Ser
    46. Saccharomyces cerevisiae YJM1434 tRNA-Ser
    47. Saccharomyces cerevisiae YJM1439 tRNA-Ser
    48. Saccharomyces cerevisiae YJM1443 tRNA-Ser
    49. Saccharomyces cerevisiae YJM1444 tRNA-Ser
    50. Saccharomyces cerevisiae YJM1447 tRNA-Ser
    51. Saccharomyces cerevisiae YJM1450 tRNA-Ser
    52. Saccharomyces cerevisiae YJM1460 tRNA-Ser
    53. Saccharomyces cerevisiae YJM1463 tRNA-Ser
    54. Saccharomyces cerevisiae YJM1477 tRNA-Ser
    55. Saccharomyces cerevisiae YJM1478 tRNA-Ser
    56. Saccharomyces cerevisiae YJM1479 tRNA-Ser
    57. Saccharomyces cerevisiae YJM1526 tRNA-Ser
    58. Saccharomyces cerevisiae YJM1527 tRNA-Ser
    59. Saccharomyces cerevisiae YJM1549 tRNA-Ser
    60. Saccharomyces cerevisiae YJM1573 tRNA-Ser
    61. Saccharomyces cerevisiae YJM1574 tRNA-Ser
    62. Saccharomyces cerevisiae YJM1592 tRNA-Ser
    63. Saccharomyces cerevisiae YJM1615 tRNA-Ser
    64. Saccharomyces cerevisiae YJM189 tRNA-Ser
    65. Saccharomyces cerevisiae YJM193 tRNA-Ser
    66. Saccharomyces cerevisiae YJM195 tRNA-Ser
    67. Saccharomyces cerevisiae YJM244 tRNA-Ser
    68. Saccharomyces cerevisiae YJM248 tRNA-Ser
    69. Saccharomyces cerevisiae YJM270 tRNA-Ser
    70. Saccharomyces cerevisiae YJM271 tRNA-Ser
    71. Saccharomyces cerevisiae YJM320 tRNA-Ser
    72. Saccharomyces cerevisiae YJM326 tRNA-Ser
    73. Saccharomyces cerevisiae YJM428 tRNA-Ser
    74. Saccharomyces cerevisiae YJM450 tRNA-Ser
    75. Saccharomyces cerevisiae YJM451 tRNA-Ser
    76. Saccharomyces cerevisiae YJM453 tRNA-Ser
    77. Saccharomyces cerevisiae YJM456 tRNA-Ser
    78. Saccharomyces cerevisiae YJM470 tRNA-Ser
    79. Saccharomyces cerevisiae YJM541 tRNA-Ser
    80. Saccharomyces cerevisiae YJM554 tRNA-Ser
    81. Saccharomyces cerevisiae YJM555 tRNA-Ser
    82. Saccharomyces cerevisiae YJM627 tRNA-Ser
    83. Saccharomyces cerevisiae YJM681 tRNA-Ser
    84. Saccharomyces cerevisiae YJM682 tRNA-Ser
    85. Saccharomyces cerevisiae YJM683 tRNA-Ser
    86. Saccharomyces cerevisiae YJM689 tRNA-Ser
    87. Saccharomyces cerevisiae YJM693 tRNA-Ser
    88. Saccharomyces cerevisiae YJM789 tRNA-Ser
    89. Saccharomyces cerevisiae YJM972 tRNA-Ser
    90. Saccharomyces cerevisiae YJM975 tRNA-Ser
    91. Saccharomyces cerevisiae YJM978 tRNA-Ser
    92. Saccharomyces cerevisiae YJM981 tRNA-Ser
    93. Saccharomyces cerevisiae YJM984 tRNA-Ser
    94. Saccharomyces cerevisiae YJM987 tRNA-Ser
    95. Saccharomyces cerevisiae YJM990 tRNA-Ser
    96. Saccharomyces cerevisiae YJM993 tRNA-Ser
    97. Saccharomyces cerevisiae YJM996 tRNA-Ser
    98. Saccharomyces mikatae tRNA-Ser
    99. Saccharomyces paradoxus tRNA-Ser
    2D structure New