Sorry, there was a problem loading sequence from server. Please try again and contact us if the problem persists.

Homo sapiens (human) hsa-miR-4429 URS0000004CA3_9606

Caution, this is an AI generated summary based on literature. This may have errors, see here for more. Please share your feedback with us.

hsa-mir-4429: Hsa-mir-4429, a microRNA, has been identified as a regulator of GNAI1 and MAPK1, AKT3, and IGF1R genes [PMC4754688]. It is significantly associated with the G-protein coupled receptor signaling pathway [PMC4754688]. The expression levels of hsa-mir-4429 have been investigated in isolated stromal cells [PMC7583725]. In infants with biliary atresia, hsa-mir-4429 has been found to be down-regulated [PMC4754688]. Hsa-mir-4429 has also been selected for further analysis as a potential diagnostic biomarker for biliary atresia [PMC4754688]. Differential expression of hsa-mir-4429 has also been observed in leiomyoma compared to myometrium, with down-regulation in leiomyoma tissue [PMC9154092]. Hsa-mir-4429 is involved in various signaling pathways, including Proteoglycans in cancer, Rap1 signaling pathway, Ras signaling pathway, and FoxO signaling pathway [PMC4754688].

Genome locations

Gene Ontology annotations

Sequence

Sequence features are shown above as colored rectangles. Zoom in and click to view details, or Reset

Search for similar sequences
AAAAGCUGGGCUGAGAGGCG

Taxonomic tree

View annotations in different species by clicking on species names.

Scroll around to explore the entire tree. Click tree nodes to collapse or expand them. Hover over taxon names to display additional information.

Publications