Sorry, there was a problem loading sequence from server. Please try again and contact us if the problem persists.

Oryza sativa (rice) osa-miR169b URS00000036DB_4530

Genome locations

Gene Ontology annotations

Sequence

Sequence features are shown above as colored rectangles. Zoom in and click to view details, or Reset

Search for similar sequences
CAGCCAAGGAUGACUUGCCGG

Taxonomic tree

View annotations in different species by clicking on species names.

Scroll around to explore the entire tree. Click tree nodes to collapse or expand them. Hover over taxon names to display additional information.

This sequence is found in 28 other species

  1. Aegilops tauschii ata-miR169d-5p
  2. Ananas comosus (pineapple) microRNA 169c
  3. Aquilegia coerulea aqc-miR169c
  4. Arabidopsis lyrata aly-miR169c-5p
  5. Arabidopsis thaliana ath-miR169c
  6. Brachypodium distachyon bdi-miR169f
  7. Brassica napus (rape) bna-miR169n
  8. Camelina sativa (false flax) cas-miR169b
  9. Citrus sinensis (sweet orange) csi-miR169m-5p
  10. Cucumis melo (muskmelon) cme-miR169f
  11. Glycine max gma-miR169f
  12. Linum usitatissimum (flax) lus-miR169j
  13. Malus domestica (apple) mdm-miR169i
  14. Manihot esculenta mes-miR169b
  15. Medicago truncatula mtr-miR169g
  16. Nicotiana tabacum (common tobacco) nta-miR169s
  17. Oryza sativa Japonica Group microRNA osa-miR169b
  18. Petunia x hybrida microRNA mirBL
  19. Populus tomentosa Pto-miR169d
  20. Populus trichocarpa ptc-miR169g
  21. Prunus persica ppe-miR169c
  22. Ricinus communis (castor bean) rco-miR169b
  23. Solanum lycopersicum sly-miR169a
  24. Sorghum bicolor sbi-miR169b
  25. Theobroma cacao tcc-miR169b
  26. Vigna unguiculata (cowpea) vun-miR169
  27. Vitis vinifera vvi-miR169a
  28. Zea mays zma-miR169c-5p
Publications