Sorry, there was a problem loading sequence from server. Please try again and contact us if the problem persists.

Solanum lycopersicum (tomato) sly-miR169a URS00000036DB_4081

Genome locations

Sorry, there was a problem loading genome locations from server. Please try again and contact us if the problem persists.

This sequence is found in {{ locations.length }} genome :

Go to location Chromosome Start End Strand Ensembl UCSC Sequence identity
Loading genome locations...
Failed to load data from server
No genome locations known
loading browser
  • Can't view - strange chromosome name
  • {{ location.chromosome }} {{ location.start | number }} {{ location.end | number }} {{ location.strand == "1" ? "forward" : "reverse" }} {{ location.ensembl_division.name.replace('EnsemblVertebrates', 'Ensembl') }} UCSC 100% {{ location.identity * 100 | number:0 }}%

    No genome locations found for this sequence. Learn more →

    Gene Ontology annotations

    Sequence

    Sequence features are shown above as colored rectangles. Zoom in and click to view details, or Reset

    Search for similar sequences
    CAGCCAAGGAUGACUUGCCGG

    Taxonomic tree

    View annotations in different species by clicking on species names.

    Scroll around to explore the entire tree. Click tree nodes to collapse or expand them. Hover over taxon names to display additional information.

    This sequence is found in 28 other species

    1. Aegilops tauschii ata-miR169d-5p
    2. Ananas comosus microRNA 169c
    3. Aquilegia coerulea aqc-miR169c
    4. Arabidopsis lyrata aly-miR169c-5p
    5. Arabidopsis thaliana (thale cress) ath-miR169c
    6. Brachypodium distachyon bdi-miR169c-5p
    7. Brassica napus bna-miR169n
    8. Camelina sativa cas-miR169b
    9. Citrus sinensis (sweet orange) csi-miR169o-5p
    10. Cucumis melo cme-miR169h
    11. Glycine max gma-miR169f
    12. Linum usitatissimum lus-miR169f
    13. Malus domestica mdm-miR169j
    14. Manihot esculenta mes-miR169d
    15. Medicago truncatula mtr-miR169b
    16. Nicotiana tabacum (common tobacco) nta-miR169s
    17. Oryza sativa Japonica Group microRNA osa-miR169b
    18. Oryza sativa osa-miR169c
    19. Petunia x hybrida microRNA mirBL
    20. Populus tomentosa Pto-miR169d
    21. Populus trichocarpa (black cottonwood) ptc-miR169d
    22. Prunus persica (peach) ppe-miR169c
    23. Ricinus communis rco-miR169b
    24. Sorghum bicolor (sorghum) sbi-miR169b
    25. Theobroma cacao (cacao) tcc-miR169k
    26. Vigna unguiculata vun-miR169
    27. Vitis vinifera (wine grape) vvi-miR169w
    28. Zea mays zma-miR169r-5p
    Publications