Sorry, there was a problem loading sequence from server. Please try again and contact us if the problem persists.

Anopheles gambiae (African malaria mosquito) aga-miR-279 URS0000003085_7165

Genome locations

Gene Ontology annotations

Sequence

Sequence features are shown above as colored rectangles. Zoom in and click to view details, or Reset

Search for similar sequences
UGACUAGAUCCACACUCAUUAA

Taxonomic tree

View annotations in different species by clicking on species names.

Scroll around to explore the entire tree. Click tree nodes to collapse or expand them. Hover over taxon names to display additional information.

This sequence is found in 18 other species

  1. Aedes aegypti (yellow fever mosquito) aae-miR-279
  2. Apis mellifera ame-miR-279a-3p
  3. Culex quinquefasciatus (southern house mosquito) cqu-miR-279-3p
  4. Drosophila ananassae dan-miR-279
  5. Drosophila erecta der-miR-279
  6. Drosophila grimshawi dgr-miR-279
  7. Drosophila melanogaster (fruit fly) dme-miR-279-3p
  8. Drosophila mojavensis dmo-miR-279
  9. Drosophila persimilis dpe-miR-279
  10. Drosophila pseudoobscura dps-miR-279
  11. Drosophila pseudoobscura pseudoobscura miRNA FBtr0294379_df_nrg
  12. Drosophila sechellia dse-miR-279
  13. Drosophila simulans dsi-miR-279
  14. Drosophila virilis dvi-miR-279-3p
  15. Drosophila willistoni dwi-miR-279
  16. Drosophila yakuba dya-miR-279
  17. Nasonia vitripennis nvi-miR-279
  18. Tribolium castaneum (red flour beetle) tca-miR-279a-3p
Publications