Sorry, there was a problem loading sequence from server. Please try again and contact us if the problem persists.

Oryza sativa (rice) osa-miR172d-5p URS0000002B3D_4530

Caution, this is an AI generated summary based on literature. This may have errors, see here for more. Please share your feedback with us.

osa-miR172d-5p: Osa-mir172d-5p is a treatment that has been shown to attenuate the fibrotic effect in idiopathic pulmonary fibrosis (IPF) compared to a negative control mimic [PMC9901827]. Inflammation plays a crucial role in acute exacerbation of IPF, and Tab1 is an essential component in inflammatory signaling [PMC9901827]. The use of osa-mir172d-5p may potentially ameliorate acute exacerbation in IPF by targeting Tab1 and reducing inflammation [PMC9901827]. This treatment has shown promise in reducing the fibrotic effect, suggesting its potential therapeutic value for IPF patients [PMC9901827]. Further research is needed to fully understand the mechanism of action and potential clinical applications of osa-mir172d-5p in the context of IPF.

Genome locations

Gene Ontology annotations

Sequence

Sequence features are shown above as colored rectangles. Zoom in and click to view details, or Reset

Search for similar sequences
GCAGCACCAUCAAGAUUCAC

Taxonomic tree

View annotations in different species by clicking on species names.

Scroll around to explore the entire tree. Click tree nodes to collapse or expand them. Hover over taxon names to display additional information.

This sequence is found in 2 other species

  1. Glycine max gma-miR172g
  2. Oryza sativa Japonica Group microRNA osa-miR172d-5p
Publications