This is the RNAcentral Browsable API. When this page is opened in a browser, it is rendered as a human-friendly document, but when the same page is requested programmatically, the response is returned in a machine-readable format. See API documentation for more details.

Rna Detail

Unique RNAcentral Sequence

API documentation

GET /api/v1/rna/URS000210972E
HTTP 200 OK Content-Type: text/html; charset=utf-8 Vary: Accept Allow: GET, HEAD, OPTIONS
{ "url": "http://rnacentral.org/api/v1/rna/URS000210972E", "rnacentral_id": "URS000210972E", "md5": "fb051b023e1f443dae09a899eceadde0", "sequence": "AGGGUUCGAUUAUGGCUCAGGACGAACGCUGGCGGCAUGCCUAACACAUGCAAGUCGAACGAGAAGCUACCUUCGGGACGUGGAGAGUGGCGCACGGGUGCGUAACACGUAGCUAACCUGCCCCCGGAUCUGGGAUACACCUUAUAAAGGAGGGCUAAUACCGGAUAACACGAAGAGCCUCAGGGUUCAUCGUUGAAAGUUCCGGCGAUCGGGGAGGGGGCCGCGUCCCAUCAGCUAGAGGGUGAUGGAAC", "length": 251, "xrefs": "http://rnacentral.org/api/v1/rna/URS000210972E/xrefs", "publications": "http://rnacentral.org/api/v1/rna/URS000210972E/publications", "is_active": false, "description": "rRNA from 0 species", "rna_type": "rRNA", "count_distinct_organisms": 1, "distinct_databases": [ "" ] }