This is the RNAcentral Browsable API. When this page is opened in a browser, it is rendered as a human-friendly document, but when the same page is requested programmatically, the response is returned in a machine-readable format. See API documentation for more details.

Rna Detail

Unique RNAcentral Sequence

API documentation

GET /api/v1/rna/URS0000000001/?flat=true
HTTP 200 OK Content-Type: text/html; charset=utf-8 Vary: Accept Allow: GET, HEAD, OPTIONS
{ "url": "http://rnacentral.org/api/v1/rna/URS0000000001", "rnacentral_id": "URS0000000001", "md5": "6bba097c8c39ed9a0fdf02273ee1c79a", "sequence": "AUUGAACGCUGGCGGCAGGCCUAACACAUGCAAGUCGAGCGGUAGAGAGAAGCUUGCUUCUCUUGAGAGCGGCGGACGGGUGAGUAAUGCCUAGGAAUCUGCCUGGUAGUGGGGGAUAACGCUCGGAAACGGACGCUAAUACCGCAUACGUCCUACGGGAGAAAGCAGGGGACCUUCGGGCCUUGCGCUAUCAGAUGAGC", "length": 200, "xrefs": [ { "database": "ENA", "is_active": false, "first_seen": "2014-05-29 00:00:00", "last_seen": "2019-12-02 00:00:00", "taxid": 77133, "accession": { "url": "http://rnacentral.org/api/v1/accession/GU793749.1:1..200:rRNA/info", "id": "GU793749.1:1..200:rRNA", "parent_ac": "GU793749", "seq_version": 1, "feature_start": 1, "feature_end": 200, "feature_name": "rRNA", "description": "uncultured bacterium partial 16S ribosomal RNA", "external_id": "", "optional_id": "", "locus_tag": "", "species": "uncultured bacterium", "inference": "", "rna_type": "rRNA", "gene": "", "product": "16S ribosomal RNA", "organelle": "", "citations": "http://rnacentral.org/api/v1/accession/GU793749.1:1..200:rRNA/citations", "expert_db_url": "", "standard_name": "", "pdb_entity_id": null, "pdb_structured_note": null, "hgnc_enembl_id": null, "hgnc_id": null, "biotype": "ncRNA", "srpdb_id": null, "ena_url": "https://www.ebi.ac.uk/ena/browser/view/Non-coding:GU793749.1:1..200:rRNA", "ensembl_species_url": "", "malacards_diseases": null }, "modifications": [], "is_rfam_seed": false, "ncbi_gene_id": null, "ndb_external_url": null, "mirbase_mature_products": null, "mirbase_precursor": null, "refseq_mirna_mature_products": null, "refseq_mirna_precursor": null, "refseq_splice_variants": null, "ensembl_splice_variants": null, "gencode_transcript_id": null, "gencode_ensembl_url": null }, { "database": "ENA", "is_active": false, "first_seen": "2014-05-29 00:00:00", "last_seen": "2019-12-02 00:00:00", "taxid": 77133, "accession": { "url": "http://rnacentral.org/api/v1/accession/GU786868.1:1..200:rRNA/info", "id": "GU786868.1:1..200:rRNA", "parent_ac": "GU786868", "seq_version": 1, "feature_start": 1, "feature_end": 200, "feature_name": "rRNA", "description": "uncultured bacterium partial 16S ribosomal RNA", "external_id": "", "optional_id": "", "locus_tag": "", "species": "uncultured bacterium", "inference": "", "rna_type": "rRNA", "gene": "", "product": "16S ribosomal RNA", "organelle": "", "citations": "http://rnacentral.org/api/v1/accession/GU786868.1:1..200:rRNA/citations", "expert_db_url": "", "standard_name": "", "pdb_entity_id": null, "pdb_structured_note": null, "hgnc_enembl_id": null, "hgnc_id": null, "biotype": "ncRNA", "srpdb_id": null, "ena_url": "https://www.ebi.ac.uk/ena/browser/view/Non-coding:GU786868.1:1..200:rRNA", "ensembl_species_url": "", "malacards_diseases": null }, "modifications": [], "is_rfam_seed": false, "ncbi_gene_id": null, "ndb_external_url": null, "mirbase_mature_products": null, "mirbase_precursor": null, "refseq_mirna_mature_products": null, "refseq_mirna_precursor": null, "refseq_splice_variants": null, "ensembl_splice_variants": null, "gencode_transcript_id": null, "gencode_ensembl_url": null }, { "database": "ENA", "is_active": false, "first_seen": "2014-05-29 00:00:00", "last_seen": "2019-12-02 00:00:00", "taxid": 77133, "accession": { "url": "http://rnacentral.org/api/v1/accession/GU792786.1:1..200:rRNA/info", "id": "GU792786.1:1..200:rRNA", "parent_ac": "GU792786", "seq_version": 1, "feature_start": 1, "feature_end": 200, "feature_name": "rRNA", "description": "uncultured bacterium partial 16S ribosomal RNA", "external_id": "", "optional_id": "", "locus_tag": "", "species": "uncultured bacterium", "inference": "", "rna_type": "rRNA", "gene": "", "product": "16S ribosomal RNA", "organelle": "", "citations": "http://rnacentral.org/api/v1/accession/GU792786.1:1..200:rRNA/citations", "expert_db_url": "", "standard_name": "", "pdb_entity_id": null, "pdb_structured_note": null, "hgnc_enembl_id": null, "hgnc_id": null, "biotype": "ncRNA", "srpdb_id": null, "ena_url": "https://www.ebi.ac.uk/ena/browser/view/Non-coding:GU792786.1:1..200:rRNA", "ensembl_species_url": "", "malacards_diseases": null }, "modifications": [], "is_rfam_seed": false, "ncbi_gene_id": null, "ndb_external_url": null, "mirbase_mature_products": null, "mirbase_precursor": null, "refseq_mirna_mature_products": null, "refseq_mirna_precursor": null, "refseq_splice_variants": null, "ensembl_splice_variants": null, "gencode_transcript_id": null, "gencode_ensembl_url": null }, { "database": "ENA", "is_active": false, "first_seen": "2014-05-29 00:00:00", "last_seen": "2019-12-02 00:00:00", "taxid": 77133, "accession": { "url": "http://rnacentral.org/api/v1/accession/GU793944.1:1..200:rRNA/info", "id": "GU793944.1:1..200:rRNA", "parent_ac": "GU793944", "seq_version": 1, "feature_start": 1, "feature_end": 200, "feature_name": "rRNA", "description": "uncultured bacterium partial 16S ribosomal RNA", "external_id": "", "optional_id": "", "locus_tag": "", "species": "uncultured bacterium", "inference": "", "rna_type": "rRNA", "gene": "", "product": "16S ribosomal RNA", "organelle": "", "citations": "http://rnacentral.org/api/v1/accession/GU793944.1:1..200:rRNA/citations", "expert_db_url": "", "standard_name": "", "pdb_entity_id": null, "pdb_structured_note": null, "hgnc_enembl_id": null, "hgnc_id": null, "biotype": "ncRNA", "srpdb_id": null, "ena_url": "https://www.ebi.ac.uk/ena/browser/view/Non-coding:GU793944.1:1..200:rRNA", "ensembl_species_url": "", "malacards_diseases": null }, "modifications": [], "is_rfam_seed": false, "ncbi_gene_id": null, "ndb_external_url": null, "mirbase_mature_products": null, "mirbase_precursor": null, "refseq_mirna_mature_products": null, "refseq_mirna_precursor": null, "refseq_splice_variants": null, "ensembl_splice_variants": null, "gencode_transcript_id": null, "gencode_ensembl_url": null }, { "database": "ENA", "is_active": false, "first_seen": "2014-05-29 00:00:00", "last_seen": "2019-12-02 00:00:00", "taxid": 77133, "accession": { "url": "http://rnacentral.org/api/v1/accession/GU792481.1:1..200:rRNA/info", "id": "GU792481.1:1..200:rRNA", "parent_ac": "GU792481", "seq_version": 1, "feature_start": 1, "feature_end": 200, "feature_name": "rRNA", "description": "uncultured bacterium partial 16S ribosomal RNA", "external_id": "", "optional_id": "", "locus_tag": "", "species": "uncultured bacterium", "inference": "", "rna_type": "rRNA", "gene": "", "product": "16S ribosomal RNA", "organelle": "", "citations": "http://rnacentral.org/api/v1/accession/GU792481.1:1..200:rRNA/citations", "expert_db_url": "", "standard_name": "", "pdb_entity_id": null, "pdb_structured_note": null, "hgnc_enembl_id": null, "hgnc_id": null, "biotype": "ncRNA", "srpdb_id": null, "ena_url": "https://www.ebi.ac.uk/ena/browser/view/Non-coding:GU792481.1:1..200:rRNA", "ensembl_species_url": "", "malacards_diseases": null }, "modifications": [], "is_rfam_seed": false, "ncbi_gene_id": null, "ndb_external_url": null, "mirbase_mature_products": null, "mirbase_precursor": null, "refseq_mirna_mature_products": null, "refseq_mirna_precursor": null, "refseq_splice_variants": null, "ensembl_splice_variants": null, "gencode_transcript_id": null, "gencode_ensembl_url": null }, { "database": "ENA", "is_active": false, "first_seen": "2014-05-29 00:00:00", "last_seen": "2019-12-02 00:00:00", "taxid": 77133, "accession": { "url": "http://rnacentral.org/api/v1/accession/GU793583.1:1..200:rRNA/info", "id": "GU793583.1:1..200:rRNA", "parent_ac": "GU793583", "seq_version": 1, "feature_start": 1, "feature_end": 200, "feature_name": "rRNA", "description": "uncultured bacterium partial 16S ribosomal RNA", "external_id": "", "optional_id": "", "locus_tag": "", "species": "uncultured bacterium", "inference": "", "rna_type": "rRNA", "gene": "", "product": "16S ribosomal RNA", "organelle": "", "citations": "http://rnacentral.org/api/v1/accession/GU793583.1:1..200:rRNA/citations", "expert_db_url": "", "standard_name": "", "pdb_entity_id": null, "pdb_structured_note": null, "hgnc_enembl_id": null, "hgnc_id": null, "biotype": "ncRNA", "srpdb_id": null, "ena_url": "https://www.ebi.ac.uk/ena/browser/view/Non-coding:GU793583.1:1..200:rRNA", "ensembl_species_url": "", "malacards_diseases": null }, "modifications": [], "is_rfam_seed": false, "ncbi_gene_id": null, "ndb_external_url": null, "mirbase_mature_products": null, "mirbase_precursor": null, "refseq_mirna_mature_products": null, "refseq_mirna_precursor": null, "refseq_splice_variants": null, "ensembl_splice_variants": null, "gencode_transcript_id": null, "gencode_ensembl_url": null }, { "database": "ENA", "is_active": false, "first_seen": "2014-05-29 00:00:00", "last_seen": "2019-12-02 00:00:00", "taxid": 77133, "accession": { "url": "http://rnacentral.org/api/v1/accession/GU786889.1:1..200:rRNA/info", "id": "GU786889.1:1..200:rRNA", "parent_ac": "GU786889", "seq_version": 1, "feature_start": 1, "feature_end": 200, "feature_name": "rRNA", "description": "uncultured bacterium partial 16S ribosomal RNA", "external_id": "", "optional_id": "", "locus_tag": "", "species": "uncultured bacterium", "inference": "", "rna_type": "rRNA", "gene": "", "product": "16S ribosomal RNA", "organelle": "", "citations": "http://rnacentral.org/api/v1/accession/GU786889.1:1..200:rRNA/citations", "expert_db_url": "", "standard_name": "", "pdb_entity_id": null, "pdb_structured_note": null, "hgnc_enembl_id": null, "hgnc_id": null, "biotype": "ncRNA", "srpdb_id": null, "ena_url": "https://www.ebi.ac.uk/ena/browser/view/Non-coding:GU786889.1:1..200:rRNA", "ensembl_species_url": "", "malacards_diseases": null }, "modifications": [], "is_rfam_seed": false, "ncbi_gene_id": null, "ndb_external_url": null, "mirbase_mature_products": null, "mirbase_precursor": null, "refseq_mirna_mature_products": null, "refseq_mirna_precursor": null, "refseq_splice_variants": null, "ensembl_splice_variants": null, "gencode_transcript_id": null, "gencode_ensembl_url": null }, { "database": "ENA", "is_active": false, "first_seen": "2014-05-29 00:00:00", "last_seen": "2019-12-02 00:00:00", "taxid": 77133, "accession": { "url": "http://rnacentral.org/api/v1/accession/GU786683.1:1..200:rRNA/info", "id": "GU786683.1:1..200:rRNA", "parent_ac": "GU786683", "seq_version": 1, "feature_start": 1, "feature_end": 200, "feature_name": "rRNA", "description": "uncultured bacterium partial 16S ribosomal RNA", "external_id": "", "optional_id": "", "locus_tag": "", "species": "uncultured bacterium", "inference": "", "rna_type": "rRNA", "gene": "", "product": "16S ribosomal RNA", "organelle": "", "citations": "http://rnacentral.org/api/v1/accession/GU786683.1:1..200:rRNA/citations", "expert_db_url": "", "standard_name": "", "pdb_entity_id": null, "pdb_structured_note": null, "hgnc_enembl_id": null, "hgnc_id": null, "biotype": "ncRNA", "srpdb_id": null, "ena_url": "https://www.ebi.ac.uk/ena/browser/view/Non-coding:GU786683.1:1..200:rRNA", "ensembl_species_url": "", "malacards_diseases": null }, "modifications": [], "is_rfam_seed": false, "ncbi_gene_id": null, "ndb_external_url": null, "mirbase_mature_products": null, "mirbase_precursor": null, "refseq_mirna_mature_products": null, "refseq_mirna_precursor": null, "refseq_splice_variants": null, "ensembl_splice_variants": null, "gencode_transcript_id": null, "gencode_ensembl_url": null }, { "database": "ENA", "is_active": false, "first_seen": "2014-05-29 00:00:00", "last_seen": "2019-12-02 00:00:00", "taxid": 77133, "accession": { "url": "http://rnacentral.org/api/v1/accession/GU793287.1:1..200:rRNA/info", "id": "GU793287.1:1..200:rRNA", "parent_ac": "GU793287", "seq_version": 1, "feature_start": 1, "feature_end": 200, "feature_name": "rRNA", "description": "uncultured bacterium partial 16S ribosomal RNA", "external_id": "", "optional_id": "", "locus_tag": "", "species": "uncultured bacterium", "inference": "", "rna_type": "rRNA", "gene": "", "product": "16S ribosomal RNA", "organelle": "", "citations": "http://rnacentral.org/api/v1/accession/GU793287.1:1..200:rRNA/citations", "expert_db_url": "", "standard_name": "", "pdb_entity_id": null, "pdb_structured_note": null, "hgnc_enembl_id": null, "hgnc_id": null, "biotype": "ncRNA", "srpdb_id": null, "ena_url": "https://www.ebi.ac.uk/ena/browser/view/Non-coding:GU793287.1:1..200:rRNA", "ensembl_species_url": "", "malacards_diseases": null }, "modifications": [], "is_rfam_seed": false, "ncbi_gene_id": null, "ndb_external_url": null, "mirbase_mature_products": null, "mirbase_precursor": null, "refseq_mirna_mature_products": null, "refseq_mirna_precursor": null, "refseq_splice_variants": null, "ensembl_splice_variants": null, "gencode_transcript_id": null, "gencode_ensembl_url": null }, { "database": "ENA", "is_active": false, "first_seen": "2014-05-29 00:00:00", "last_seen": "2019-12-02 00:00:00", "taxid": 77133, "accession": { "url": "http://rnacentral.org/api/v1/accession/GU790934.1:1..200:rRNA/info", "id": "GU790934.1:1..200:rRNA", "parent_ac": "GU790934", "seq_version": 1, "feature_start": 1, "feature_end": 200, "feature_name": "rRNA", "description": "uncultured bacterium partial 16S ribosomal RNA", "external_id": "", "optional_id": "", "locus_tag": "", "species": "uncultured bacterium", "inference": "", "rna_type": "rRNA", "gene": "", "product": "16S ribosomal RNA", "organelle": "", "citations": "http://rnacentral.org/api/v1/accession/GU790934.1:1..200:rRNA/citations", "expert_db_url": "", "standard_name": "", "pdb_entity_id": null, "pdb_structured_note": null, "hgnc_enembl_id": null, "hgnc_id": null, "biotype": "ncRNA", "srpdb_id": null, "ena_url": "https://www.ebi.ac.uk/ena/browser/view/Non-coding:GU790934.1:1..200:rRNA", "ensembl_species_url": "", "malacards_diseases": null }, "modifications": [], "is_rfam_seed": false, "ncbi_gene_id": null, "ndb_external_url": null, "mirbase_mature_products": null, "mirbase_precursor": null, "refseq_mirna_mature_products": null, "refseq_mirna_precursor": null, "refseq_splice_variants": null, "ensembl_splice_variants": null, "gencode_transcript_id": null, "gencode_ensembl_url": null }, { "database": "ENA", "is_active": false, "first_seen": "2014-05-29 00:00:00", "last_seen": "2019-12-02 00:00:00", "taxid": 77133, "accession": { "url": "http://rnacentral.org/api/v1/accession/GU794138.1:1..200:rRNA/info", "id": "GU794138.1:1..200:rRNA", "parent_ac": "GU794138", "seq_version": 1, "feature_start": 1, "feature_end": 200, "feature_name": "rRNA", "description": "uncultured bacterium partial 16S ribosomal RNA", "external_id": "", "optional_id": "", "locus_tag": "", "species": "uncultured bacterium", "inference": "", "rna_type": "rRNA", "gene": "", "product": "16S ribosomal RNA", "organelle": "", "citations": "http://rnacentral.org/api/v1/accession/GU794138.1:1..200:rRNA/citations", "expert_db_url": "", "standard_name": "", "pdb_entity_id": null, "pdb_structured_note": null, "hgnc_enembl_id": null, "hgnc_id": null, "biotype": "ncRNA", "srpdb_id": null, "ena_url": "https://www.ebi.ac.uk/ena/browser/view/Non-coding:GU794138.1:1..200:rRNA", "ensembl_species_url": "", "malacards_diseases": null }, "modifications": [], "is_rfam_seed": false, "ncbi_gene_id": null, "ndb_external_url": null, "mirbase_mature_products": null, "mirbase_precursor": null, "refseq_mirna_mature_products": null, "refseq_mirna_precursor": null, "refseq_splice_variants": null, "ensembl_splice_variants": null, "gencode_transcript_id": null, "gencode_ensembl_url": null }, { "database": "ENA", "is_active": true, "first_seen": "2020-08-19 00:00:00", "last_seen": "2022-01-22 00:00:00", "taxid": 77133, "accession": { "url": "http://rnacentral.org/api/v1/accession/GU792481.1:1..200:rRNA/info", "id": "GU792481.1:1..200:rRNA", "parent_ac": "GU792481", "seq_version": 1, "feature_start": 1, "feature_end": 200, "feature_name": "rRNA", "description": "uncultured bacterium partial 16S ribosomal RNA", "external_id": "", "optional_id": "", "locus_tag": "", "species": "uncultured bacterium", "inference": "", "rna_type": "rRNA", "gene": "", "product": "16S ribosomal RNA", "organelle": "", "citations": "http://rnacentral.org/api/v1/accession/GU792481.1:1..200:rRNA/citations", "expert_db_url": "", "standard_name": "", "pdb_entity_id": null, "pdb_structured_note": null, "hgnc_enembl_id": null, "hgnc_id": null, "biotype": "ncRNA", "srpdb_id": null, "ena_url": "https://www.ebi.ac.uk/ena/browser/view/Non-coding:GU792481.1:1..200:rRNA", "ensembl_species_url": "", "malacards_diseases": null }, "modifications": [], "is_rfam_seed": false, "ncbi_gene_id": null, "ndb_external_url": null, "mirbase_mature_products": null, "mirbase_precursor": null, "refseq_mirna_mature_products": null, "refseq_mirna_precursor": null, "refseq_splice_variants": null, "ensembl_splice_variants": null, "gencode_transcript_id": null, "gencode_ensembl_url": null }, { "database": "ENA", "is_active": true, "first_seen": "2020-08-19 00:00:00", "last_seen": "2022-01-22 00:00:00", "taxid": 77133, "accession": { "url": "http://rnacentral.org/api/v1/accession/GU792786.1:1..200:rRNA/info", "id": "GU792786.1:1..200:rRNA", "parent_ac": "GU792786", "seq_version": 1, "feature_start": 1, "feature_end": 200, "feature_name": "rRNA", "description": "uncultured bacterium partial 16S ribosomal RNA", "external_id": "", "optional_id": "", "locus_tag": "", "species": "uncultured bacterium", "inference": "", "rna_type": "rRNA", "gene": "", "product": "16S ribosomal RNA", "organelle": "", "citations": "http://rnacentral.org/api/v1/accession/GU792786.1:1..200:rRNA/citations", "expert_db_url": "", "standard_name": "", "pdb_entity_id": null, "pdb_structured_note": null, "hgnc_enembl_id": null, "hgnc_id": null, "biotype": "ncRNA", "srpdb_id": null, "ena_url": "https://www.ebi.ac.uk/ena/browser/view/Non-coding:GU792786.1:1..200:rRNA", "ensembl_species_url": "", "malacards_diseases": null }, "modifications": [], "is_rfam_seed": false, "ncbi_gene_id": null, "ndb_external_url": null, "mirbase_mature_products": null, "mirbase_precursor": null, "refseq_mirna_mature_products": null, "refseq_mirna_precursor": null, "refseq_splice_variants": null, "ensembl_splice_variants": null, "gencode_transcript_id": null, "gencode_ensembl_url": null }, { "database": "ENA", "is_active": true, "first_seen": "2020-08-19 00:00:00", "last_seen": "2022-01-22 00:00:00", "taxid": 77133, "accession": { "url": "http://rnacentral.org/api/v1/accession/GU793749.1:1..200:rRNA/info", "id": "GU793749.1:1..200:rRNA", "parent_ac": "GU793749", "seq_version": 1, "feature_start": 1, "feature_end": 200, "feature_name": "rRNA", "description": "uncultured bacterium partial 16S ribosomal RNA", "external_id": "", "optional_id": "", "locus_tag": "", "species": "uncultured bacterium", "inference": "", "rna_type": "rRNA", "gene": "", "product": "16S ribosomal RNA", "organelle": "", "citations": "http://rnacentral.org/api/v1/accession/GU793749.1:1..200:rRNA/citations", "expert_db_url": "", "standard_name": "", "pdb_entity_id": null, "pdb_structured_note": null, "hgnc_enembl_id": null, "hgnc_id": null, "biotype": "ncRNA", "srpdb_id": null, "ena_url": "https://www.ebi.ac.uk/ena/browser/view/Non-coding:GU793749.1:1..200:rRNA", "ensembl_species_url": "", "malacards_diseases": null }, "modifications": [], "is_rfam_seed": false, "ncbi_gene_id": null, "ndb_external_url": null, "mirbase_mature_products": null, "mirbase_precursor": null, "refseq_mirna_mature_products": null, "refseq_mirna_precursor": null, "refseq_splice_variants": null, "ensembl_splice_variants": null, "gencode_transcript_id": null, "gencode_ensembl_url": null }, { "database": "ENA", "is_active": true, "first_seen": "2020-08-19 00:00:00", "last_seen": "2022-01-22 00:00:00", "taxid": 77133, "accession": { "url": "http://rnacentral.org/api/v1/accession/GU793583.1:1..200:rRNA/info", "id": "GU793583.1:1..200:rRNA", "parent_ac": "GU793583", "seq_version": 1, "feature_start": 1, "feature_end": 200, "feature_name": "rRNA", "description": "uncultured bacterium partial 16S ribosomal RNA", "external_id": "", "optional_id": "", "locus_tag": "", "species": "uncultured bacterium", "inference": "", "rna_type": "rRNA", "gene": "", "product": "16S ribosomal RNA", "organelle": "", "citations": "http://rnacentral.org/api/v1/accession/GU793583.1:1..200:rRNA/citations", "expert_db_url": "", "standard_name": "", "pdb_entity_id": null, "pdb_structured_note": null, "hgnc_enembl_id": null, "hgnc_id": null, "biotype": "ncRNA", "srpdb_id": null, "ena_url": "https://www.ebi.ac.uk/ena/browser/view/Non-coding:GU793583.1:1..200:rRNA", "ensembl_species_url": "", "malacards_diseases": null }, "modifications": [], "is_rfam_seed": false, "ncbi_gene_id": null, "ndb_external_url": null, "mirbase_mature_products": null, "mirbase_precursor": null, "refseq_mirna_mature_products": null, "refseq_mirna_precursor": null, "refseq_splice_variants": null, "ensembl_splice_variants": null, "gencode_transcript_id": null, "gencode_ensembl_url": null }, { "database": "ENA", "is_active": true, "first_seen": "2020-08-19 00:00:00", "last_seen": "2022-01-22 00:00:00", "taxid": 77133, "accession": { "url": "http://rnacentral.org/api/v1/accession/GU793944.1:1..200:rRNA/info", "id": "GU793944.1:1..200:rRNA", "parent_ac": "GU793944", "seq_version": 1, "feature_start": 1, "feature_end": 200, "feature_name": "rRNA", "description": "uncultured bacterium partial 16S ribosomal RNA", "external_id": "", "optional_id": "", "locus_tag": "", "species": "uncultured bacterium", "inference": "", "rna_type": "rRNA", "gene": "", "product": "16S ribosomal RNA", "organelle": "", "citations": "http://rnacentral.org/api/v1/accession/GU793944.1:1..200:rRNA/citations", "expert_db_url": "", "standard_name": "", "pdb_entity_id": null, "pdb_structured_note": null, "hgnc_enembl_id": null, "hgnc_id": null, "biotype": "ncRNA", "srpdb_id": null, "ena_url": "https://www.ebi.ac.uk/ena/browser/view/Non-coding:GU793944.1:1..200:rRNA", "ensembl_species_url": "", "malacards_diseases": null }, "modifications": [], "is_rfam_seed": false, "ncbi_gene_id": null, "ndb_external_url": null, "mirbase_mature_products": null, "mirbase_precursor": null, "refseq_mirna_mature_products": null, "refseq_mirna_precursor": null, "refseq_splice_variants": null, "ensembl_splice_variants": null, "gencode_transcript_id": null, "gencode_ensembl_url": null }, { "database": "ENA", "is_active": true, "first_seen": "2020-08-19 00:00:00", "last_seen": "2022-01-22 00:00:00", "taxid": 77133, "accession": { "url": "http://rnacentral.org/api/v1/accession/GU786868.1:1..200:rRNA/info", "id": "GU786868.1:1..200:rRNA", "parent_ac": "GU786868", "seq_version": 1, "feature_start": 1, "feature_end": 200, "feature_name": "rRNA", "description": "uncultured bacterium partial 16S ribosomal RNA", "external_id": "", "optional_id": "", "locus_tag": "", "species": "uncultured bacterium", "inference": "", "rna_type": "rRNA", "gene": "", "product": "16S ribosomal RNA", "organelle": "", "citations": "http://rnacentral.org/api/v1/accession/GU786868.1:1..200:rRNA/citations", "expert_db_url": "", "standard_name": "", "pdb_entity_id": null, "pdb_structured_note": null, "hgnc_enembl_id": null, "hgnc_id": null, "biotype": "ncRNA", "srpdb_id": null, "ena_url": "https://www.ebi.ac.uk/ena/browser/view/Non-coding:GU786868.1:1..200:rRNA", "ensembl_species_url": "", "malacards_diseases": null }, "modifications": [], "is_rfam_seed": false, "ncbi_gene_id": null, "ndb_external_url": null, "mirbase_mature_products": null, "mirbase_precursor": null, "refseq_mirna_mature_products": null, "refseq_mirna_precursor": null, "refseq_splice_variants": null, "ensembl_splice_variants": null, "gencode_transcript_id": null, "gencode_ensembl_url": null }, { "database": "ENA", "is_active": true, "first_seen": "2020-08-19 00:00:00", "last_seen": "2022-01-22 00:00:00", "taxid": 77133, "accession": { "url": "http://rnacentral.org/api/v1/accession/GU794138.1:1..200:rRNA/info", "id": "GU794138.1:1..200:rRNA", "parent_ac": "GU794138", "seq_version": 1, "feature_start": 1, "feature_end": 200, "feature_name": "rRNA", "description": "uncultured bacterium partial 16S ribosomal RNA", "external_id": "", "optional_id": "", "locus_tag": "", "species": "uncultured bacterium", "inference": "", "rna_type": "rRNA", "gene": "", "product": "16S ribosomal RNA", "organelle": "", "citations": "http://rnacentral.org/api/v1/accession/GU794138.1:1..200:rRNA/citations", "expert_db_url": "", "standard_name": "", "pdb_entity_id": null, "pdb_structured_note": null, "hgnc_enembl_id": null, "hgnc_id": null, "biotype": "ncRNA", "srpdb_id": null, "ena_url": "https://www.ebi.ac.uk/ena/browser/view/Non-coding:GU794138.1:1..200:rRNA", "ensembl_species_url": "", "malacards_diseases": null }, "modifications": [], "is_rfam_seed": false, "ncbi_gene_id": null, "ndb_external_url": null, "mirbase_mature_products": null, "mirbase_precursor": null, "refseq_mirna_mature_products": null, "refseq_mirna_precursor": null, "refseq_splice_variants": null, "ensembl_splice_variants": null, "gencode_transcript_id": null, "gencode_ensembl_url": null }, { "database": "ENA", "is_active": true, "first_seen": "2020-08-19 00:00:00", "last_seen": "2022-01-22 00:00:00", "taxid": 77133, "accession": { "url": "http://rnacentral.org/api/v1/accession/GU790934.1:1..200:rRNA/info", "id": "GU790934.1:1..200:rRNA", "parent_ac": "GU790934", "seq_version": 1, "feature_start": 1, "feature_end": 200, "feature_name": "rRNA", "description": "uncultured bacterium partial 16S ribosomal RNA", "external_id": "", "optional_id": "", "locus_tag": "", "species": "uncultured bacterium", "inference": "", "rna_type": "rRNA", "gene": "", "product": "16S ribosomal RNA", "organelle": "", "citations": "http://rnacentral.org/api/v1/accession/GU790934.1:1..200:rRNA/citations", "expert_db_url": "", "standard_name": "", "pdb_entity_id": null, "pdb_structured_note": null, "hgnc_enembl_id": null, "hgnc_id": null, "biotype": "ncRNA", "srpdb_id": null, "ena_url": "https://www.ebi.ac.uk/ena/browser/view/Non-coding:GU790934.1:1..200:rRNA", "ensembl_species_url": "", "malacards_diseases": null }, "modifications": [], "is_rfam_seed": false, "ncbi_gene_id": null, "ndb_external_url": null, "mirbase_mature_products": null, "mirbase_precursor": null, "refseq_mirna_mature_products": null, "refseq_mirna_precursor": null, "refseq_splice_variants": null, "ensembl_splice_variants": null, "gencode_transcript_id": null, "gencode_ensembl_url": null }, { "database": "ENA", "is_active": true, "first_seen": "2020-08-19 00:00:00", "last_seen": "2022-01-22 00:00:00", "taxid": 77133, "accession": { "url": "http://rnacentral.org/api/v1/accession/GU786683.1:1..200:rRNA/info", "id": "GU786683.1:1..200:rRNA", "parent_ac": "GU786683", "seq_version": 1, "feature_start": 1, "feature_end": 200, "feature_name": "rRNA", "description": "uncultured bacterium partial 16S ribosomal RNA", "external_id": "", "optional_id": "", "locus_tag": "", "species": "uncultured bacterium", "inference": "", "rna_type": "rRNA", "gene": "", "product": "16S ribosomal RNA", "organelle": "", "citations": "http://rnacentral.org/api/v1/accession/GU786683.1:1..200:rRNA/citations", "expert_db_url": "", "standard_name": "", "pdb_entity_id": null, "pdb_structured_note": null, "hgnc_enembl_id": null, "hgnc_id": null, "biotype": "ncRNA", "srpdb_id": null, "ena_url": "https://www.ebi.ac.uk/ena/browser/view/Non-coding:GU786683.1:1..200:rRNA", "ensembl_species_url": "", "malacards_diseases": null }, "modifications": [], "is_rfam_seed": false, "ncbi_gene_id": null, "ndb_external_url": null, "mirbase_mature_products": null, "mirbase_precursor": null, "refseq_mirna_mature_products": null, "refseq_mirna_precursor": null, "refseq_splice_variants": null, "ensembl_splice_variants": null, "gencode_transcript_id": null, "gencode_ensembl_url": null }, { "database": "ENA", "is_active": true, "first_seen": "2020-08-19 00:00:00", "last_seen": "2022-01-22 00:00:00", "taxid": 77133, "accession": { "url": "http://rnacentral.org/api/v1/accession/GU786889.1:1..200:rRNA/info", "id": "GU786889.1:1..200:rRNA", "parent_ac": "GU786889", "seq_version": 1, "feature_start": 1, "feature_end": 200, "feature_name": "rRNA", "description": "uncultured bacterium partial 16S ribosomal RNA", "external_id": "", "optional_id": "", "locus_tag": "", "species": "uncultured bacterium", "inference": "", "rna_type": "rRNA", "gene": "", "product": "16S ribosomal RNA", "organelle": "", "citations": "http://rnacentral.org/api/v1/accession/GU786889.1:1..200:rRNA/citations", "expert_db_url": "", "standard_name": "", "pdb_entity_id": null, "pdb_structured_note": null, "hgnc_enembl_id": null, "hgnc_id": null, "biotype": "ncRNA", "srpdb_id": null, "ena_url": "https://www.ebi.ac.uk/ena/browser/view/Non-coding:GU786889.1:1..200:rRNA", "ensembl_species_url": "", "malacards_diseases": null }, "modifications": [], "is_rfam_seed": false, "ncbi_gene_id": null, "ndb_external_url": null, "mirbase_mature_products": null, "mirbase_precursor": null, "refseq_mirna_mature_products": null, "refseq_mirna_precursor": null, "refseq_splice_variants": null, "ensembl_splice_variants": null, "gencode_transcript_id": null, "gencode_ensembl_url": null }, { "database": "ENA", "is_active": true, "first_seen": "2020-08-19 00:00:00", "last_seen": "2022-01-22 00:00:00", "taxid": 77133, "accession": { "url": "http://rnacentral.org/api/v1/accession/GU793287.1:1..200:rRNA/info", "id": "GU793287.1:1..200:rRNA", "parent_ac": "GU793287", "seq_version": 1, "feature_start": 1, "feature_end": 200, "feature_name": "rRNA", "description": "uncultured bacterium partial 16S ribosomal RNA", "external_id": "", "optional_id": "", "locus_tag": "", "species": "uncultured bacterium", "inference": "", "rna_type": "rRNA", "gene": "", "product": "16S ribosomal RNA", "organelle": "", "citations": "http://rnacentral.org/api/v1/accession/GU793287.1:1..200:rRNA/citations", "expert_db_url": "", "standard_name": "", "pdb_entity_id": null, "pdb_structured_note": null, "hgnc_enembl_id": null, "hgnc_id": null, "biotype": "ncRNA", "srpdb_id": null, "ena_url": "https://www.ebi.ac.uk/ena/browser/view/Non-coding:GU793287.1:1..200:rRNA", "ensembl_species_url": "", "malacards_diseases": null }, "modifications": [], "is_rfam_seed": false, "ncbi_gene_id": null, "ndb_external_url": null, "mirbase_mature_products": null, "mirbase_precursor": null, "refseq_mirna_mature_products": null, "refseq_mirna_precursor": null, "refseq_splice_variants": null, "ensembl_splice_variants": null, "gencode_transcript_id": null, "gencode_ensembl_url": null } ], "publications": "http://rnacentral.org/api/v1/rna/URS0000000001/publications", "is_active": true, "description": "rRNA from 13 species", "rna_type": "rRNA", "count_distinct_organisms": 1, "distinct_databases": [ "ENA" ] }