This is the RNAcentral Browsable API. When this page is opened in a browser, it is rendered as a human-friendly document, but when the same page is requested programmatically, the response is returned in a machine-readable format. See API documentation for more details.

Rna Sequences

Unique RNAcentral Sequences

API documentation

GET /api/v1/rna/?database=rfam
HTTP 200 OK Content-Type: text/html; charset=utf-8 Vary: Accept Allow: GET, HEAD, OPTIONS
{ "next": "http://rnacentral.org/api/v1/rna/?database=rfam&page=2", "previous": null, "results": [ { "url": "http://rnacentral.org/api/v1/rna/URS0002109729", "rnacentral_id": "URS0002109729", "md5": "fb0512f9250442ce8b55863f4c54cf51", "sequence": "GACGAACGCUGGCGGCGUGCUUAACACAUGCAAGUCGAACGGAAAGGCCCCUUUGGGGGUACUCGAGUGGCGAACGGGUUAGUAACACGUGAGUAACCUGCCCUUGACUUCGGGAUAACUUCAGGAAACUGGGGCUAAUACCGGAUAGGAAUCCUUGCUGCAUGGUGGGGGUUGGAAAGCUUCGGCGGUUUUGGAUGGACUCGCGGCUUAUCAGCUUGUUGGUGGGGUAGUGGCUUACCAAGGCUUUGACGGGUAGCCGGCCUGAGAGGGCGACCGGCCACGGGGGGACUGAGGGACGGCCCAGACUCCGACGGGGGGCAGCAGUGGGGAGGAGUGCGCAAGGGGCGGGAGCCGGAUGCAGCAGGGCCGCGGGCGGGAUGACGGCCUUCGGGUUGUAAACCGCUUUCAGCAGGGGCGAAGCUUGUGGUGACGGUACCUGCAGAAGAAGCACCGGCUAACUACGUG", "length": 465, "xrefs": "http://rnacentral.org/api/v1/rna/URS0002109729/xrefs", "publications": "http://rnacentral.org/api/v1/rna/URS0002109729/publications", "is_active": true, "description": "rRNA from 13 species", "rna_type": "rRNA", "count_distinct_organisms": 1, "distinct_databases": [ "ENA" ] }, { "url": "http://rnacentral.org/api/v1/rna/URS000210972A", "rnacentral_id": "URS000210972A", "md5": "fb05134b9606f13d7f5228632dbb7c55", "sequence": "AAAACCGUUAGGGAAUCUUGCACAAUGGAGGAAACUCUUAUGCAGCGAUGCCGCGUGAGUGAAGAAGGCCUUUGGGUUGUAAAGCUAGUUCGUCGUGGAAGAAAAUUACUGUACCCGAAUCAGAAGGUCCGGCUAAAUUCGUGCCAGCAGCCGCGGUAAUACGAAGGGACCUAGCGUAGUUCGGAAUUACUGUGCUUCAAGAGUUCGUAGGUGGUUAAAAAAUCUGGUGUUGAAAUCCCAGAGCUUAACUCUUGAACUGCCAUCAAAACUUUUUAGCUAUAGUAUGAUAGAGGAAAGCAGAAUUUCUAGUGUAGAGGUGAAAUUCGUAGAUAUUAGAAAGAAUACCAAUUGCGAAGGCAGCUUUCUGGAUCAUUACUGACACUGAGGAACGAAAGCAUGGGUAGCGAAGAGG", "length": 412, "xrefs": "http://rnacentral.org/api/v1/rna/URS000210972A/xrefs", "publications": "http://rnacentral.org/api/v1/rna/URS000210972A/publications", "is_active": false, "description": "rRNA from 0 species", "rna_type": "rRNA", "count_distinct_organisms": 1, "distinct_databases": [ "" ] }, { "url": "http://rnacentral.org/api/v1/rna/URS000210972B", "rnacentral_id": "URS000210972B", "md5": "fb0513e3fd7bb503f76161a1ec077d82", "sequence": "GACGAACGCUGGCGGCGUGCUUAACACAUGCAAGUCGAACGGAAAGGCCCUGCUUUUGUGGGGUGCUCGAGUGGCGAACGGGUGAGUAACACGUGAGUAACCUGCCCUUGACUUUGGGAUAACUUCAGGCAACUGGGGCUAAUACCGGAUAGGAGCUCCUGCUGCAUGGUGGGGGUUGGAAAGUUUCGGCGGUUGGGGAUGGACUCGCGGCUUAUCAGCUUGUGGGUGGGGUAGUGGCUUACCCAGGCUUUGACGGGUAGCCGGCCUGAGAGGGUGACCGGCCACAUUGGGACUGAGAUACGGACCAGACUCCUACGGUAGGCAGCAGUGGGGAAUAUUGCACAAUGGGCGGAAGCCUGAGGCAGCAACGCCGCGUGCGGGAUGACGGCCUUCGGGUUGUAAACCGCUUUCGCUUGUGACGAAGCGGGAGUGACGGUAAUGGGUAAAGAAGCACCGGCUAACUACGUG", "length": 468, "xrefs": "http://rnacentral.org/api/v1/rna/URS000210972B/xrefs", "publications": "http://rnacentral.org/api/v1/rna/URS000210972B/publications", "is_active": true, "description": "rRNA from 13 species", "rna_type": "rRNA", "count_distinct_organisms": 1, "distinct_databases": [ "ENA" ] }, { "url": "http://rnacentral.org/api/v1/rna/URS000210972C", "rnacentral_id": "URS000210972C", "md5": "fb05146e70e7bdc02b9603073bda3c34", "sequence": "GUGCCAGCAGCCGCGGUAACACGUAGGGGGCGAGCGUUAUCCGGAAUUACUGGGCGUAAAGGGUGCGUAGGCGGCCUUUUAAGUCAGAUGUGAAAGGCUACGACUUAACCGUAGUUAGCAUUUGAAACUAAGAGGCUUGAGUGCAGGAGAGGAGAGUGGAAUUCCUAGUGUAGCGGUGAAAUGCGUAGAUAUUAGGAGGAACACCAGUGGCGAAGGCGACUCUCUGGACUGCAACUGACGCUGAGGCACGAAAGCGUGGGUAGCGAACAGGAUUAGAUACCCUUGUAGUCC", "length": 291, "xrefs": "http://rnacentral.org/api/v1/rna/URS000210972C/xrefs", "publications": "http://rnacentral.org/api/v1/rna/URS000210972C/publications", "is_active": false, "description": "rRNA from 0 species", "rna_type": "rRNA", "count_distinct_organisms": 1, "distinct_databases": [ "" ] }, { "url": "http://rnacentral.org/api/v1/rna/URS000210972D", "rnacentral_id": "URS000210972D", "md5": "fb051921d221e701efeebec22a44ea75", "sequence": "UGAGGAAUAUUGGUCAAUGGGCGGGAGCCUGAACCAGCCAAGUCGCGUGAGGGAAGACGGUCCUAUGGAUUGUAAACCUCUUUUGUCGGGGAGCAAAGAAGUCACGUGUGACUAAAAGUGAGAGUACCCGAAGAAAAAGCAUCGGCUAACUCCGUGCCAGCAGCCGCGGUAAUACGGAGGAUGCGAGCGUUAUCCGGAUUUAUUGGGUUUAAAGGGUGCGUAGGCGGACUGGUAAGUCAGCGGUAAAAUCGAGGGGCUCAACCCCUUUCCGCCGUUGAAACUGCCGUGCUUGAGUGGGCGAAGAGUAUGCGGAAUGCGUGGUGUAGCGGUGAAAUGCAUGGAUGUCACGCAGAACUCCGAUUGCGAAGGCAGCAUACCGGCGCCCGACUGACGCUGAGGCACGGAAGCGUGGGGAUCGAACA", "length": 422, "xrefs": "http://rnacentral.org/api/v1/rna/URS000210972D/xrefs", "publications": "http://rnacentral.org/api/v1/rna/URS000210972D/publications", "is_active": false, "description": "rRNA from 0 species", "rna_type": "rRNA", "count_distinct_organisms": 1, "distinct_databases": [ "" ] }, { "url": "http://rnacentral.org/api/v1/rna/URS000210972E", "rnacentral_id": "URS000210972E", "md5": "fb051b023e1f443dae09a899eceadde0", "sequence": "AGGGUUCGAUUAUGGCUCAGGACGAACGCUGGCGGCAUGCCUAACACAUGCAAGUCGAACGAGAAGCUACCUUCGGGACGUGGAGAGUGGCGCACGGGUGCGUAACACGUAGCUAACCUGCCCCCGGAUCUGGGAUACACCUUAUAAAGGAGGGCUAAUACCGGAUAACACGAAGAGCCUCAGGGUUCAUCGUUGAAAGUUCCGGCGAUCGGGGAGGGGGCCGCGUCCCAUCAGCUAGAGGGUGAUGGAAC", "length": 251, "xrefs": "http://rnacentral.org/api/v1/rna/URS000210972E/xrefs", "publications": "http://rnacentral.org/api/v1/rna/URS000210972E/publications", "is_active": false, "description": "rRNA from 0 species", "rna_type": "rRNA", "count_distinct_organisms": 1, "distinct_databases": [ "" ] }, { "url": "http://rnacentral.org/api/v1/rna/URS000210972F", "rnacentral_id": "URS000210972F", "md5": "fb051b9118de7de3e180edc5c6d20c89", "sequence": "UGGGGAAUAUUGGACAAUGGGCGCAAGCCUGAUCCAGCCAUGCCGCGUGAGUGAUGAAGGCCUUAGGGUUGUAAAGCUCUUUCGCCGGUGAAGAUAAUGACGGUAACCGGAGAAGAAGCCCCGGCUAACUUCGUGCCAGCAGCCGCGGUAAUACGAAGGGGGCUAGCGUUGCUCGGAAUCACUGGGCGUAAAGCGCACGUAGGCGGAUCGUUAAGUCAGGGGUGAAAUCCUGGGGCUCAACCUCAGAACUGCCCUUGAUACUGGCGAUCUAGAGUUCGAGAGAGGUUGGUGGAACUCCGAGUGUAGAGGUGAAAUUCGUAGAUAUUCGGAAGAACACCAGUGGCGAAGGCGGCCAACUGGCUCGAUACUGACGCUGAGGUGCGAAAGCGUGGGGAGCAAACAGG", "length": 404, "xrefs": "http://rnacentral.org/api/v1/rna/URS000210972F/xrefs", "publications": "http://rnacentral.org/api/v1/rna/URS000210972F/publications", "is_active": false, "description": "rRNA from 0 species", "rna_type": "rRNA", "count_distinct_organisms": 1, "distinct_databases": [ "" ] }, { "url": "http://rnacentral.org/api/v1/rna/URS0002109730", "rnacentral_id": "URS0002109730", "md5": "fb051ccf17bd627bedf85d9464d07349", "sequence": "GAUGAAGAACGUAGCAAAAUGCGAUAAGUAAUGUGAAUUGCAGAAUUUAGUGAAUCAUCGAAUCUUUGAACGCAUAUUGCGCCCGCCAGCACUCUGGCGGGCAUGCCUGUUCGAGCGUCAUUUCAACCCUCAGGCCUCGUGUCUGGCGUUGGAGCGCUGCGGCCCUCCCGCAGGCCCCCAAAUCUAGCGGCGGACCCGCCCGGCCCUGAGCGCAGUAGAGAGUAGACUCUUACGCUUCGGCGGCCGUGGCGCGGUUUAUUCCUUCCGCCCCGUAGCGCCAAUGGCGCCACCCCAAUAAGUUGACCUCGGAUCAGGUAGGACUACCCGCUGAACUUAAGCAUAUCAAUAAGCGGAGGA", "length": 357, "xrefs": "http://rnacentral.org/api/v1/rna/URS0002109730/xrefs", "publications": "http://rnacentral.org/api/v1/rna/URS0002109730/publications", "is_active": true, "description": "misc_RNA from 11 species", "rna_type": "misc_RNA", "count_distinct_organisms": 1, "distinct_databases": [ "ENA" ] }, { "url": "http://rnacentral.org/api/v1/rna/URS0002109731", "rnacentral_id": "URS0002109731", "md5": "fb052625d7841571f55c085e5eab35b8", "sequence": "GAUGAAGAACGUAGCGAAAUGCGAUACUUGGUGUGAAAUGCAGAAUCCCGUGAACCAUCGAGUCUUUGAACGCAAGUUGCGCCCGAAGCCAUUAGGCCGAGGGCACGUCUGCCUGGGCGUCACACAACGUUGCCCCCCCAAACCUCGACUUCCAAGAGGACGGGGGGCGGAUGCUGGCCUCCCGUGUGCCACGGCUCGCGGUUGGCCUAAAUGCGAGUACUCGGCGACGAGCGCCGCGGCAAUCGGUGGUUGUCUAACCCUCGGUGCCAUGCUGCGCGCGCGAUUCGCUCACUGUUACUCGACGACCCCAAUGCGUCGUAGCCACGACCCUCACAACGCGACCCCAGGUCAGGCGGGGCUACCCGCUGAGUUUAAGCAUAUCAAUAAGCGGAGGA", "length": 395, "xrefs": "http://rnacentral.org/api/v1/rna/URS0002109731/xrefs", "publications": "http://rnacentral.org/api/v1/rna/URS0002109731/publications", "is_active": true, "description": "misc_RNA from 11 species", "rna_type": "misc_RNA", "count_distinct_organisms": 1, "distinct_databases": [ "ENA" ] }, { "url": "http://rnacentral.org/api/v1/rna/URS0002109732", "rnacentral_id": "URS0002109732", "md5": "fb052e019d4138ddc9821a1f589c229b", "sequence": "GAUGAAGAACGCAGCGAAAUGCGAUAAGUAGUGUGAAUUGCAGAAUUCAGUGAAUCAUCGAAUCUUUGAACGCACAUUGCGCCCCUUGGUAUCCCGAGGGGCAUGCCUGUUCGAGCGUCAUUUCACCACUCAAGCCUGGCUUGGCGUUGGGCGACGUCCCAUUUGGGGACGCGUCUCGAAACGCUCGGCGGCGUGGCACCGGCUUUAAGCGUAGCAGAAUCUUUCGCUUCAAGAGUCGGGGCCCCGUCUGCCGGAAGACCUACCCAUAAGGUUGACCUCGGAUCAGGCAGGGAUACCCGCUGAACUUAAGCAUAUCAAUAAGCGGAGGA", "length": 329, "xrefs": "http://rnacentral.org/api/v1/rna/URS0002109732/xrefs", "publications": "http://rnacentral.org/api/v1/rna/URS0002109732/publications", "is_active": true, "description": "misc_RNA from 11 species", "rna_type": "misc_RNA", "count_distinct_organisms": 1, "distinct_databases": [ "ENA" ] } ] }