This is the RNAcentral Browsable API. When this page is opened in a browser, it is rendered as a human-friendly document, but when the same page is requested programmatically, the response is returned in a machine-readable format. See API documentation for more details.

Rna Sequences

Unique RNAcentral Sequences

API documentation

GET /api/v1/rna/
HTTP 200 OK Content-Type: text/html; charset=utf-8 Vary: Accept Allow: GET, HEAD, OPTIONS
{ "next": "http://rnacentral.org/api/v1/rna/?page=2", "previous": null, "results": [ { "url": "http://rnacentral.org/api/v1/rna/URS0000E62068", "rnacentral_id": "URS0000E62068", "md5": "06cf697ee3ccff3149ad4283ce7fee34", "sequence": "AUGGGGGAACAAAUAACAUCGGGUUUGCAAAAGCACAGGGAAAAAGGUAUGUUAGUUCUUGCUGAGGCUGCAGACAACGUGGGGGUACCUGAACUCGUCCUGUGUGUAACGUUGUACUGCUCAGCUUGGAAGUCAGGGGAGGAGAAGCAACGUGUAUCUGCAAAACAGAAGUGCUGUGCUGCAAAACAGGUGUUUAUUUCUCUCUUUCCCAUUCCCAGGGAUUUGCUCCAAGAGAACAAUUUCUGUCUGGUCAGAAGCAGGUACAAAAAUUAGUGGUGAAUGUGCAGGGUGAGCUGACUCAUCUUCAAAGCAAACCGCCUUAGAAAUGACAGCAGAAAGCGAAGGUGGAAGCUGCGUCCAGGCUCUGUGAUGCUACACUGGCAUGCGGCAGGAGCAGCAACCCGCUCUGCAGGCACACAGCAGAGCCCUGAGGCUGUGACAAGCGAGAGGGCUGCGCCAGUGGUGGCUCCAGGUCUGCACAUGGAAAGCACCCGCUCCUGUUACCUGCCCUUCUGCAGGGCUCAGCCCGCAAGUACGGAGCCAGCCACCUAGAGGUUCCUGAAAUUAACUCUCAAGAAGGUCUGACUUCUAAUUUUCUGUCGUAAACAGCCACAAGGCAUAGCUCGCACAUCAGCUGAGCAUAUAUUACUGAAAUAAUUGAUUUUUAAAUUAAAGCUCUGAAGAAGAGUGAGGAAAGUACCGGUUUUUCCAAACUGAAGCUCUAUGGGCAGCAGUUUGAAUCAAUACGCUAGGAAGUUUCUAUUUUUCUUCAUAAUGUUCAGACUGCUGUUUUGCCUGAUUCUGAAGCAGCAGAUGAUGCGCCCUCUUGUAGAUGCCAUGUAUAUUAUGAACCACGCUUCGUACUUUCCUCCCCUCUUUGAGGUACAUGGGGAGGAGCACAGACUUGAUACGCAGAGAUGUAACUGAUGCCACGAUCACCUUGUGAGACCUGCCUGUGUCCUGCUGAGCUCUGACUUUCUCACAGACUUUGUUAUUCUUCAUAUGGUUAUAUCAAAUGAGUUGACAUAACAAAAAGGGAUUUAAGGCCAAGAAAUGAAAUUGCUCAGUCUGCCGAACCCUUGCUUUAAUUCCUCCUCACCCACCCACUGCUUUUGUGCCUUAUUUUCUCAUUUUGACAAACGGGCUGAGGUUCUAGCUCAGUCUGGGGGCUGGGGUGGUGGAGCUGAGCACUCCUUUUAAAAAAAAUAAAACUCAGAAAAAUCUCA", "length": 1226, "xrefs": "http://rnacentral.org/api/v1/rna/URS0000E62068/xrefs", "publications": "http://rnacentral.org/api/v1/rna/URS0000E62068/publications", "is_active": true, "description": "lncRNA from 12 species", "rna_type": "lncRNA", "count_distinct_organisms": 1, "distinct_databases": [ "Ensembl" ] }, { "url": "http://rnacentral.org/api/v1/rna/URS0000E62069", "rnacentral_id": "URS0000E62069", "md5": "06d00732ef8b61ab4e4e3700566682f6", "sequence": "ACGCAUGAUGACGGAAAUUCUUCACUUUGACCUGAUGUCUGUUGAAGAAACUCACUAUCUGAGG", "length": 64, "xrefs": "http://rnacentral.org/api/v1/rna/URS0000E62069/xrefs", "publications": "http://rnacentral.org/api/v1/rna/URS0000E62069/publications", "is_active": true, "description": "snoRNA from 14 species", "rna_type": "snoRNA", "count_distinct_organisms": 1, "distinct_databases": [ "Ensembl" ] }, { "url": "http://rnacentral.org/api/v1/rna/URS0000E6206A", "rnacentral_id": "URS0000E6206A", "md5": "06d02d35e691e12bcc62efc5253736db", "sequence": "UUUGUUUUACCCAAGACACGCUUUAAAGGGAAUUUCCACAGUAUGAAUCAUAAACUACUUUUCCUGGCACUUAUGACACAGUUAUUAGCCAUAAUGAAACAAAACCACUUCUUAGCUUAUCCAUUGUCUCAGCUAUCCAGACUACUUGCUCAGACUCCAGACUUACCAUUUUCAAAUCCAGUUUCCAGAUUUUGGAACAACAAGGAAGUUUUUUUACCUCCCUGCCUGCCAUCUGAUACCUCCAGGGAAGGAAUUGUACUUGAUCAACACAUCAAAGAGCUACUCAACACAGCUCACACACUGUCAUGGACCCAGAGGGACAGCCUUCCAUCUUCAGCUUCCUCUGUGAAAAAUGAAGUUUAUUUCCUACCUGUGGGGACUUUUUACCAUCUUAUACCAUCUACACUUUCCCCAGAGCCUGGUGAAGGGACUUUGAUCCCAAAAGCUUGCAGAAAAGGACAACUUGCCACUUUCCAGUUGGUCUAAUAAAAGGUAUCAUUUUCAAACCAAGAGUUCUAGUUUUUUGUAUGCCUAGGUUGACCCCUGGCUUUCCAAUUUGAAAAGU", "length": 565, "xrefs": "http://rnacentral.org/api/v1/rna/URS0000E6206A/xrefs", "publications": "http://rnacentral.org/api/v1/rna/URS0000E6206A/publications", "is_active": true, "description": "lncRNA from 11 species", "rna_type": "lncRNA", "count_distinct_organisms": 1, "distinct_databases": [ "Ensembl" ] }, { "url": "http://rnacentral.org/api/v1/rna/URS0000E6206B", "rnacentral_id": "URS0000E6206B", "md5": "06d0bcb3360d6b80916adf246ace5bc9", "sequence": "AUACCCCGAUAUCUGGGUGAGGACCCCAGUGCCUUCAGUGGGACCCCAACAUCUGGAUAGGGACCCCAGUGUCCUCAUGGGGACCCCAACAUCUGGAUGAGGACCCCAACAUCUGGGCGAUGACCCCAAUAUCUGGGCGAGGACCCCAGUGCUUUCAUGGGACCCCCAACGCGUGGAUGGGGACCCCAACAUGGGUAUGGAGACCCCGAAAUCCGGGUGAGGACCCCAAAGCCUUCAGUGGGAUCCCAAUGUCCAGGUGGGGACCCCAACAUCUGGGGGGACCCCAACAUCUGGACUGGGACCUUAGUGUCCAGGUGGGGACCCCAACAUCUGGGUGGGGGGGACCCCAACAUCUGGACCGGGGCCUUAGUGUCCAGGUGGGGACCCCAACAUCUGGGUGGGGGGGACCCCAACAUCUGGACCGGGACCUCAAUGUCCAGGUGGGGACCCCAACAUCUGGGGGAGGGGGACCCCAACAUCUGGAUGGGGACCCUGAUGUCCGGGCCGUGCCUUCUGUUCCCAAGUGCCCUCAAUAAAGUGUGGUGCCGCGGUGAUAUCGGUGUCCGAGGGGGGGGGCGGGGGUGGGACACGUGCAAACACACGCAUGUGCACAAGAGCUCACG", "length": 623, "xrefs": "http://rnacentral.org/api/v1/rna/URS0000E6206B/xrefs", "publications": "http://rnacentral.org/api/v1/rna/URS0000E6206B/publications", "is_active": true, "description": "lncRNA from 12 species", "rna_type": "lncRNA", "count_distinct_organisms": 1, "distinct_databases": [ "Ensembl" ] }, { "url": "http://rnacentral.org/api/v1/rna/URS0000E6206C", "rnacentral_id": "URS0000E6206C", "md5": "06d125f062590ee58dd780a7e69acbe9", "sequence": "UACGCCGGGUGGCCGUUACGGCGGCCGCUAACGGCGCCGCUGCGCGAGCCGCCCUCACGUGACCCUCCACGCGACUACAAGGGGGCACCGCCUGACGGCAGCGGCCAUCUUUGACCCUGGCGGUCGACUUCUGGGCGGCCUCGCUACGGGGCGACCUGACUACARUUUCUAGUCUGUCUAAUCCAAGCUGAGCCGCUAAGCUAUCCUGUGAGAAAGGCGAAGCCGCUCCAUCCUGGCGAGCUAAGCCGGAGCUCAGUUUAAAGAUGACGACCUUUUCCCGCCCCCAAAUAGCCUCUGGCUCCCAGAGCCUGGGCCAGCUGUUGCCCAGGUUUCACAGGGCGCAUGCGCCCUGUGGACACUGGGCAGCUUCACCGCCAUGAUGAAACGGGGAAAACUGCCUCUUGCGCCUGCGCGCUGAAGAACUUGGGCAACCACRUCGCCAUGAUGAAAGGGGGUGGGGAUCGCCGCCUGCACCUGCGCAGUGAAGCGGGGGCCAAGUGGAGGCGCGGGAGGAGGGGGUUGUGCGGAGUGGGGUUACUCGUCUGCUCUCCUCGUGGUGGGCAGGUGCCCUGGUCCUUUGUACUUGCCUUGGGAUCGACCCUAGAAAGGUGUACUGGUACUUUUCCGUGGGUCUGUAAUCUAGAGCACCAUUUUUCUACGGAAGAAAAGGACCCCAAAUCAGUCUUGUGCAUUGUAGAGUAAUAGUGAUGCCUGUGUUCCUAAAGGAUACCCCGAUUCUAGAAGUCUGUCUACACRGAGCAUGGUUUGUAUAAAUUUAUGCUGGAACUUGCUUCAUUGAAUCACUUUCAGCAACUGACUUAACCUUCAAGUGUUUUGGUAUGUUUAAAGUCCUGCUUUCUGAAUAAGAAUGUACAWUUUUUUCAGAACAAUUCUGCCAGGUGAAGGUGAGUAAGUGAAAAUACUGGCUCAGAUGAAAGGUUCAUCUAUUCCAGUGUCCUGUCUUCAACUAUGAUCCAGAACAGGUGUCAAGGGAAAAGUUUAAGGCAGGGCAGUUUUUUUGUAGUGUCUACACAUUUAACCUCAGUAUCAUACCCUACUAUGACAUUCAAUAAAUCUAUGUGGGGAUAACA", "length": 1091, "xrefs": "http://rnacentral.org/api/v1/rna/URS0000E6206C/xrefs", "publications": "http://rnacentral.org/api/v1/rna/URS0000E6206C/publications", "is_active": true, "description": "lncRNA from 11 species", "rna_type": "lncRNA", "count_distinct_organisms": 1, "distinct_databases": [ "Ensembl" ] }, { "url": "http://rnacentral.org/api/v1/rna/URS0000E6206D", "rnacentral_id": "URS0000E6206D", "md5": "06d1bec5e12805ef5fd8c43a7dbc1626", "sequence": "GUUUACUUUAAAAAAUCAAGCCUGGCUUGAAAACAGAGGCCAGUGGAUACUUGUUGGCAGCCUUCUCUGACAGAGCCUGCACCAGCAUCAAGGGCCUGAUUGGAGUCCCCACCCACCGCAUGGCCAAAAGCAAAUUCUAAUCAGGAGACAAAAUCACAUGGAAGGCAGAAAGUAUGGAAAAGGGGCCAUCUACUAUGAAAAAGAUGCGGGUACAAUUUGUGAGACUUCAGGGCGAGUUUUCAUCGGCAGCAAGAACUACCUGUCCUGUCUGCUGCAGCUCAGAGAUCCAGUGGCCAUCCUUGUGCAGGAAAUGGAAGCAGCCUCCUUAGGAAUAUUGACAGCCAAGGUCUCCUGAGAUACUUUGGUGACACAAAGAUAGAUGACAAUUGACGCAAACCCAGGUAAUCCAGCCAACAGAGGCCUCUUGAGGAAGCGACAGUGUGACAUUUGACAUUUCAAGUUCUACCAGUGGACUUUCAGCGGGAGUGACAGAGCAAGGCUAAGUGCAUAGUUUAUUCCAAACUUCAGUUUUAUUGUUAACUUGCCAAUACUGUGAAGAACUUACCGCCUUGGUACACAGAAUGCAAGGUUAGAAAUGACAGACCUUGUCCUGAAAAAAAAAAUAGUGAAGAGGGCUUAGGGCAGAGAGGAUGGCUCAGCAGGUAAAGCACUUGCUGUUCAAACUCAAGAGCAUCUACAUAAAAAGCUAGGUAUAGCCUGUAACCACAGUGCUCAGGAGCAGGCACGGAACUAGAAGGAUGCUGCGGUUGGCUUGCCGCCAGCCUAGUUUUAGGUUCAGUGAAAAACUCUUGCAAGAGAAUAAGACAGAAAGUGAUAGAGAAGGACACUUGAUAUCCUCUUGUGGUCUCAGCAUAUACAUGGGUACAUACAUGUACCUGCAUACACAACACAUACAUAAAUACACACACACAUACACACACACACUUAC", "length": 949, "xrefs": "http://rnacentral.org/api/v1/rna/URS0000E6206D/xrefs", "publications": "http://rnacentral.org/api/v1/rna/URS0000E6206D/publications", "is_active": true, "description": "lncRNA from 10 species", "rna_type": "lncRNA", "count_distinct_organisms": 1, "distinct_databases": [ "Ensembl" ] }, { "url": "http://rnacentral.org/api/v1/rna/URS0000E6206E", "rnacentral_id": "URS0000E6206E", "md5": "06d1daae1a018279a2a57901017302a3", "sequence": "GGACACCAGGAGGACACUGGGGGGACACCAUGGACACCAAGGGGGACACCAGGAGGACACUGGGGUGGAUGGUGACACCAGGGGGAUGGGACCUCUGGGGGAACCUGGGGACACCGGGGACACCAGGAGGACAUUGGAGGGACACCAUGGACACCAGGGGGACACGGGGGACACCAGGAGGACACUUUGGGGGAGACCAUGGACACGGGGAGGGGGGACCCUGGGGACACCGGGGGGGGGGGACCUGGGGCACCGCAGCCGAGCACCGGGAGGGGCCCAGGUGUCCGGGUCCAGCACCAUCUCCCCGCCGUCCUCCUCCAUCUCCCCCUCUCCCCUCCCAUCCCUCCUUCCUCCUCUCCCUCCCUCCCUCUCUUCCUCCCUCCCUCCAUCUCCCUCCAUCCCUCCCUCCUUCCUUCCCUGCCUCUCUCCAUCUCUCCUUCUCUGCCUCCGUCACUCCUGCCCUCCCUCUCCUCCUCCAUCCCUCCCUCCCUGCUCCUCCUCCAUCCCUUGCUUCCCUCCGUCGUUCCCUGCACAUCUCCCUCUCUCUGGGCACUUCUCCGUCUCUCCUUCCCUCCCUCCUUUCCUCCAUCCCUCCGUCCAUCUCUCCUCUCCCUUCCUCCAUCCUUCCAUCUCCUCAUCCCUCCUUCCAUCCCUCCCUCCCUCCAUCCCUCUUUCCAUCCCUCCCUCCUUCCAUCCCUCCUCUGCCUUCUUCCAUCCUUUCAUCCCUCCUUCCAUCCCUCCAUCCUUCUCUCCAUCCUCUCCUUCCAUCCCUCCUUUUCCCUUCCCUCCUCUCUUCCUCCAUGCUUUCACUCCUCCUUCCAUCUCUCCAUGCCUCCCUCCGCCACUCCCUCCAUCCCUCCCUCUGUCCCUCUUUCCGUCCCUCUCUCCUUUACUCCCUCCUUCUGUCCCUCCAUCUCCCCUCUCCCUCCAUCUCCUCUCUCUUCCUCCGUCCCUCCUUCCAUCCCUUUCUCCUUUACUCCCUCCUUCUGUCCCUCCAUCUCCCCUUUCCCUUCCUCCAUCCCUCCAUUCCUUCCUCCAUCCCUCUCUCCUUCCCUCCCUCCAUCUCCCCUCUCCCUUCCUCCCUGCUUCCAUCCCUCCUUCCAUCUCUCCCUGCUUCCCUCCCUCCAUCUCCCCUCCCUCCUCUCCCUUCCUCCCUCCCUGCUUCCAUCCAUCUCUCCCUCCCUCCAUCUCCCCCCAGCACACGCACACGCCAUCGCCCGCGCGGCCUCCGCACGCACACGCCCCGGCACGCUCCGGCACGCGCGCCGAGCGCCGCACACGCACAGUGUUGCACACGCACGCACACGCACGCACACACGUGCACACGCAUGCACACGCACCGAGUGUUGCACACGCAGCAGCCCCGGGCCGUGCACACGCGCUUCUGCACCGUGCACACGCGCUCGCAGCUGUGCGCGUGCACACUCAGCACUGCGCACUCACACUCAGCCCCAUGCACGCUCGGCCCCAGCCGGGCACACUCACACUCACCACCAGCUGGGCACACUCACACUCACCCCUGGACUGGUGCAUGCUCACCCCCAGCCGGGCACACUCACACUCACUUCAGUGGUGCACACUCACACUCACCCCUGGACUGGUGCAUGCUCACUCCCAGCUGUGCACACUCACACUCACUUCAGUGGUGCACACUCACACUCAUCCCCAGCCGUGCACACUCACACUCACCCCUGGACUGGUGCAUGCUCACCCCCAGCUGUGCACACUCACACUCACCACCAGCGAUGCACACUCGCACUCACCCCUGGAGUGUGCACAGGCACACUCAGCCCUGCAGCCGUGCACACUCACACUCACUUCAGCAGUGCACACUCACACUCACCUCUGGACUGGUGCACACUCAGCCCUGCAGCUGUGCUCACUCACACUCACCCCUGGACCCACGCACACUCAAACUCACCCCCAGACCUGUGCACACUCACACUCACCCCAGCUGUGCACACUCACCCCUGCAGCCAUGCACGCUCACACUCACCCCAGCCACACACACUCACACUCACCCUCAGCAGUGCACACUCACACUCACCCCUGGACCGGUGCAUGCUCAGCCCAGCCGUGCACACUCACUCUCACCCCCAGCGGUGCACACUCACCCCCAAGCAUGCACACUCACACUCACUCCAGCCAUGCACACUCACCCUCACCCCCAGCGGUGCACACUCACCCCCAGGCAUGCACACUCACACUCACCCCUGGACCCGUGCACAUUCACCCCCAGGCAUGCACACUCACACUCGCACUCACCCCAGCCAUGCACACUCACACUCAGCCCGGGCCCUUGCUCGUGGCCGUGCACGGGCACUCACACUCACUCCCGGCAGUGCACACUCACCCCCCAGCAAUGCACACUCACCCCCGGCAGUGCACACUCACCCCAGAGACAUGCAAACUUGCACUCACCGGAGGUGUCCUGCACACUCACCCCUGGCCGUGCACGCUCACACUCACUCCCGGCACCAUGCACACUCACCCCCGGCACCAUGCACACUCACUCUCGGCACCGUGCACACUCACUCCAAGCUGUGCACGCUCACACUCACUCCCGGCACCGUGCACACUCACUCCCGGCACCAUGCACACUCACACUCACUCCCGGCACCGUGCAC", "length": 2627, "xrefs": "http://rnacentral.org/api/v1/rna/URS0000E6206E/xrefs", "publications": "http://rnacentral.org/api/v1/rna/URS0000E6206E/publications", "is_active": true, "description": "lncRNA from 12 species", "rna_type": "lncRNA", "count_distinct_organisms": 1, "distinct_databases": [ "Ensembl" ] }, { "url": "http://rnacentral.org/api/v1/rna/URS0000E6206F", "rnacentral_id": "URS0000E6206F", "md5": "06d248267d5983942f76fe24c966128a", "sequence": "CUCUCUCUCACACACCAUCUGUCUGUCUGCCUGUCUCUUUCUUCCCCCGGGGUCAAAAAAUGGAGAGGGACCCUAGAUGUCACACCACGUUGAAAGGCUUCUCUCAGGCAUAUAAGCUGUUAUAAUGUGGACUGUGACAACAGUCAAUGUUUUGCUUGCUGUCUCUGCUGGGAAAGUCAUAAAGUUAGCAUUAGAAACUACCUGAAACACUGAUUUUUGCCACCAGAGGUGGCAAAACUCCCCAAAGUCCUAGAGCCAUUCUCUCCAUUCUGGCCCACCUUUAUAAAGAUUGUUAUUACCACUAGAGCCAACUGUAACACAGCCUCCGCAGACGGCCUGUUGAAGAACACGUGCAAAUCAGAACUAACUCAGAGAGAUGCCUCAACAGAAGUCAGCAGGUCCUUGCUUCCUGAAAUAUGCUCCGUGAAGCUUCUCCAGGACACCAUGAGGACAUGGCGUCUAUCUGCAACAGGCUUCCAUAUGUCCAUGCCUGUGGGCAUCAGGAAGUGUAGCUGCAGGGAGUCUGAUACUCAGUUUUGCAGAGCUGAGUUGUACCUGGUGUUGUCGUUGUAGUAAAUAUGCCCCAUUCACUGCAGCCCUGUCACUUGAGACUGCCAGAUCCAGUGCCAGUAUGUGUUCUCCAGACAGCACAGGUCAGGGUGAGGGUCUCUCCAGGUUCACCACUCCUGGGCCAGACUGGACCAGCUGCACUUGGGACAAGACACCUGGAAACAGAAAGACUGGAGUGAAAUACAAUGCAACUCAUCUUUUGUUUGGUGGUGAGGGCAGUUGAACUCCUGGCUACUAAGUGAACAGCAGUCAGAACUGGCUGUAGAGAACAUCCCCCUGAGACAUGGACCUGGAGUGAGGAGGGAGAGAGAGGAGAGAAACAGCCAUAGUGGGUGUGUCCAGAUGAGCACAAGUGUGCCUCUUGCAGCAUCUCAAACCCUUUUGAGAAGCUGCAAGAUGCAUGUGCAGGAACAAAAAAACGCUCCUCAUGCUACAUAGAUGCAAUGCAGGGGCAAAAUCUGGUACCUGGAUAUCCAGGUACCAAAAUAAAACCCUGAGGAAAAAAGUGGGGCA", "length": 1083, "xrefs": "http://rnacentral.org/api/v1/rna/URS0000E6206F/xrefs", "publications": "http://rnacentral.org/api/v1/rna/URS0000E6206F/publications", "is_active": true, "description": "lncRNA from 11 species", "rna_type": "lncRNA", "count_distinct_organisms": 1, "distinct_databases": [ "Ensembl" ] }, { "url": "http://rnacentral.org/api/v1/rna/URS0000E62070", "rnacentral_id": "URS0000E62070", "md5": "06d39f3b782af5de5cc7e48ef4f576e4", "sequence": "GUGACUGCUUUUUGUUCUAAGGUGCAUCUAGUGCAGAUAGUGAAGUAGAUUAGCAUCUACUGCCCUAAGUGCUCCUUCUGGCAUAAGAAGUUGU", "length": 94, "xrefs": "http://rnacentral.org/api/v1/rna/URS0000E62070/xrefs", "publications": "http://rnacentral.org/api/v1/rna/URS0000E62070/publications", "is_active": true, "description": "pre_miRNA from 20 species", "rna_type": "pre_miRNA", "count_distinct_organisms": 3, "distinct_databases": [ "Ensembl" ] }, { "url": "http://rnacentral.org/api/v1/rna/URS0000E62E53", "rnacentral_id": "URS0000E62E53", "md5": "0b72cd8e6fbf18b395fe790c3fdcb9fd", "sequence": "AGUUUAAAGAAUCAAGAGCCAUAAAGAUGAAGUGUCCAAACCAGACCUGUAACUGGUGGGAGAGUUACAGGUUAGCAUACCUACAUGGAAUUCAAACAUGCUAAUUUGGGCAGAAAAAUAUGCUCACUUGCCACUUCACCUGGAAAACCAAAGAGAAACUGGCAGUGAAGAGAAGCAUAUGAAGAAAGAGAGAGAAUGCAGAAGAAAGGAAGAAAAGUAUUAAAACCUGAAGACUCAACAGCUGACCUGAGCUCCAAGUUGUGGAACCUAUUCCUGAAAUCAGAGGAAGCUUUCUGGAGAACCAAACUGCAACCAAAUAUUUUCGAAGUCCUGGAACAAGUAGAGAGAGGGUUUUUAUUUUGA", "length": 363, "xrefs": "http://rnacentral.org/api/v1/rna/URS0000E62E53/xrefs", "publications": "http://rnacentral.org/api/v1/rna/URS0000E62E53/publications", "is_active": true, "description": "lncRNA from 12 species", "rna_type": "lncRNA", "count_distinct_organisms": 1, "distinct_databases": [ "Ensembl" ] } ] }