Sorry, there was a problem loading sequence from server. Please try again and contact us if the problem persists.

Homo sapiens (human) HOXB cluster antisense RNA 4 (HOXB-AS4) URS0002123147_9606

Caution, this is an AI generated summary based on literature. This may have errors, see here for more. Please share your feedback with us.

HOXB-AS4: HOXB-AS4 is a long non-coding RNA (lncRNA) that is encoded by the HOXB gene cluster. It is one of the 18 lncRNAs identified in the HOX gene clusters, which are located in four regions: HOXA, HOXB, HOXC, and HOXD [PMC9819025]. In various cancers, including cholangiocarcinoma (CCA) and clear cell renal cell carcinoma (ccRCC), HOXB-AS4 has been found to be differentially expressed and associated with prognosis [PMC6180422] [PMC10082204]. In ccRCC, a lncRNA-based signature including HOXB-AS4 has been developed to classify patients into high-risk and low-risk groups based on overall survival (OS) [PMC6886334]. Additionally, in pancreatic cancer cells, specific methylation of HOXB-AS4 has been identified [PMC7056837] [PMC8806254]. Furthermore, co-expression analysis has revealed correlations between HOXB-AS4 and other lncRNAs within the same gene clusters [PMC8602076]. The prognostic effect of higher expression levels of HOXB-AS4 has been observed in various cancers such as ccRCC and lung adenocarcinoma (LUAD), where it is associated with inferior OS [PMC10082204] [PMC8957844] [PMC8602076] [PMC7756030]. Further research on the molecular characteristics of lncRNAs such as AC007907.1, AC025419.1, AC078993.1, AC090241.2, AL158166.1 AL355974.2 AL596330.1 KLHL6-AS1 LHX1-DT LINC00528 LINC01436 TTTY14 will provide valuable insights into cancer development and progression as well as potential therapeutic targets [PMC6886334].

Genome locations

Gene Ontology annotations

Sequence

Sequence features are shown above as colored rectangles. Zoom in and click to view details, or Reset

Search for similar sequences
CACUGCGCUCUGACUGCCGUCUUCCUGGUUCCCCUUCCCUCUCCUGCCCUGACUUUGCAGCUGCCUCUCUGCAACAAGAGAGGAGUCAAGAGGACCACUCAGUUUAGGGAAGAAGUUAGAGGAAGAAGAACACUUGGGCUGAUGGCUUGUGCUCUACAAGGCGGCCAGACCUUUGCCCAGCCCUGCCCGUUUAUUGCCGGGUACUUGCUGGAAGGGGACAGAAGAUAAGACUCGGGGUGACUCCCAAGGCCUGAAGGGGGCUGAUUGGGCCGGGGGCUCCCAGAGGAUAAACCUAGGGGCCGGUCGGUCUUCCUCGGCGUGGAAGUGAGAGCCACGCGGCGUGGCGGAGCUCCACCACCGUCUCCUUAUCUCUUUAAAGCCUCAAAAUCAAACAAAACCACUACUACCCAGGCCUCAAGUUUCCACAGUUUUUGUCUGCUCUGGACCGUUUACUUUUUUUGAAAAAAGAGAACUUGGUGGAAUCCAAAUUCUCUACUAGGCCUCCGAACCAAAACGAAGGAAAAUCCGUUUUCUUCUUGGGCU

Taxonomic tree

View annotations in different species by clicking on species names.

Scroll around to explore the entire tree. Click tree nodes to collapse or expand them. Hover over taxon names to display additional information.

Publications