Contains ambiguity characters: 63 T IUPAC notation
Sequence features are shown above as colored rectangles. Zoom in and click to view details, or Reset
AAGACTATACTTTCAGGGATCATTTCTCTAGTTCAATACTACAGAAGTTTCTCTGAAGGTGTAGCAAGCACCAGAAACCACGAGGAAAGTGCAGTATTCTCTCCCAAGTGTGATGCCGCCCGTCTCTTGATGTTGCTTTGCTCAGCTGCCATTCGGCATTGATGATTGTTTTATCCTTCCTTAGGAAGAGTGAGAGGGAAAGGATGCAGTCCAAGTGG
View annotations in different species by clicking on species names.
Scroll around to explore the entire tree. Click tree nodes to collapse or expand them. Hover over taxon names to display additional information.