Sorry, there was a problem loading sequence from server. Please try again and contact us if the problem persists.

Homo sapiens (human) Hsa-Mir-616_5p (mature (guide)) URS0000EFE401_9606

Caution, this is an AI generated summary based on literature. This may have errors, see here for more. Please share your feedback with us.

hsa-mir-616: Hsa-mir-616 is a microRNA (miRNA) that has been studied in various contexts [PMC4526194]. In one study, four miRNAs, including hsa-mir-616, showed differences during differentiation, suggesting an interaction between status and differentiation variables [PMC4526194]. Another study suggested that hsa-mir-616 should be further evaluated to determine its role in ovarian cancer survival [PMC8148489]. In a functional assay, the presence of hsa-mir-616 efficiently reduced luciferase expression in a specific plasmid compared to another variant (P < 0.05) [PMC4505847]. This finding was consistent with in silico analysis and suggested a functional interaction between hsa-mir-616 and the target mRNA [PMC4505847]. Further functional assays indicated that hsa-mir-616 may affect mRNA expression by degrading it [PMC4505847]. Additionally, an integrative analysis showed that certain single nucleotide polymorphisms (SNPs) may change the binding activity of miRNAs, including hsa-mir-616, with the target gene [PMC4505847]. Another study found that hsa-mir-616 was one of the miRNAs significantly affected by vitamin D treatment in SCC-25 cells [PMC7551909]. Overall, these studies highlight the potential role of hsa-mir-616 in various biological processes and its potential as a therapeutic target or biomarker.

Genome locations

Gene Ontology annotations

Sequence

Sequence features are shown above as colored rectangles. Zoom in and click to view details, or Reset

Search for similar sequences
ACUCAAAACCCUUCAGUGACUUCC

Taxonomic tree

View annotations in different species by clicking on species names.

Scroll around to explore the entire tree. Click tree nodes to collapse or expand them. Hover over taxon names to display additional information.

Publications