Sorry, there was a problem loading sequence from server. Please try again and contact us if the problem persists.

Homo sapiens (human) Hsa-Mir-770_5p (mature (guide)) URS0000EFD7FA_9606

Caution, this is an AI generated summary based on literature. This may have errors, see here for more. Please share your feedback with us.

hsa-mir-770: Hsa-mir-770 is a microRNA that has been found to be significantly upregulated in urine and blood samples from patients with diabetic nephropathy (DN) [PMC9266798]. The hsa-mir-770 precursor expression vector, named miR-770, was constructed with synthetic oligonucleotides and incorporated into a plasmid [PMC6276177]. In breast cancer, hsa-mir-770 is one of the 10 miRNAs that are significantly downregulated compared to normal tissues in patients with good prognosis [PMC8004706]. In another study, hsa-mir-770 was found to be lower in MMVP specimens compared to FED samples [PMC4881574]. Additionally, hsa-mir-770 has been identified as one of the most downregulated miRNAs in various cellular conditions such as testicular germ cell, embryonal carcinoma cell, and hippocampus cell [PMC7820843]. Overall, these findings suggest that hsa-mir-770 may play a role in the pathogenesis of DN and breast cancer prognosis. Further research is needed to fully understand the functional significance of hsa-mir-770 in these conditions.

Genome locations

Gene Ontology annotations

Sequence

Sequence features are shown above as colored rectangles. Zoom in and click to view details, or Reset

Search for similar sequences
UCCAGUACCACGUGUCAGGGCCACA

Taxonomic tree

View annotations in different species by clicking on species names.

Scroll around to explore the entire tree. Click tree nodes to collapse or expand them. Hover over taxon names to display additional information.

This sequence is found in 1 other species

Publications