v24

Sorry, there was a problem loading sequence from server. Please try again and contact us if the problem persists.

Homo sapiens (human) long intergenic non-protein coding RNA 2690 URS0000EF490F_9606

Caution, this is an AI generated summary based on literature. This may have errors, see here for more. Please share your feedback with us.

LINC02690: LINC02690, also known as GCAT1 (granulosa cell-associated transcript 1), is a long non-coding RNA (lncRNA) that is downregulated in the granulosa cells (GCs) of patients with biochemical premature ovarian insufficiency (bPOI) [PMC8969497]. This downregulation of LINC02690 is considered a novel form of lncRNA-mediated epigenetic regulation that contributes to the pathogenesis of POI [PMC8969497]. In granulosa cell models, LINC02690, also referred to as GCAT1, competes with p27Kip1 mRNA for binding to PTBP1 [PMC9028986]. In a study involving 24 patients with bPOI and 24 age-matched controls, it was found that LINC02690 was significantly downregulated in the GCs and showed a significant correlation with serum levels of basic FSH and anti-Müllerian hormone (AMH), both commonly used indicators of ovarian reserve [PMC7733005]. The downregulation of LINC02690 facilitated the binding of CDKN1B mRNA to PTBP1, leading to the translation of CDKN1B protein (p27) [PMC7733005]. Among several lncRNA candidates, LINC02690 was selected for further investigation due to its potential pathological and clinical value [PMC7733005]. It has also been recently demonstrated that LINC02690 is downregulated in granulosa cells from patients with biochemical POI [PMC8430788]. Overall, these findings highlight the role of LINC02690/GCAT1 in GC function and its potential involvement in the pathogenesis and clinical indicators of POI.

Genome locations

Gene Ontology annotations

Sequence

Sequence features are shown above as colored rectangles. Zoom in and click to view details, or Reset

Search for similar sequences 
GGGAGCCCUGGUUGCCAUAACAACUGAUUGGUCCUCUCCUCUUCCUCCACCUCUGCCACAGGGCUCCAGCUUCCCUCUGGGGGCACCACUGUUCUUAGAUGGCAGAGCAGAUGCAACGGCACCCCUGAGCUGCCCUCAGGGGGUCCUCAGCCUUGGAGGAGGCAGGAGACCUGGGCUAUGGAGCCACUCACAGGCCCUACUGAGAACAACUUGGUGUCCAUCACAGUCCUCUUCAGAAUGCCCAGAAUAUGGGGAUAAGAAGGUGAAACCGGCAUGUUUAUUAACACAAUGGAAUAUUCUGUGGCCAAAUCAAAGGAAGACGUUGAGGAUUCUGGUGACACCUGGAAACGUACUGCUAAGGGAAAAAAGCAGGACCACAAUGUUAUGUGGAUAUUGACUGCGACUAUAUAUAAUGCCAGCGUGGACUUCUCAGAGAUGGAAUUUGGAGGAAUGUAAUACAGAUGCAAAUAGAGUUUUCCCCACAUUGCCUUCUCCCGCGGUGUUUCUUCAUCUCUGUCAACAGCCUUGCCACCUACUCUGUUGCCCAAACCAGAAACUUGAUUCAAACUACACUUCUCCCUCUGCCCUCAUGCCCCGUUCCUGUUAGUCACAAGUCCUGCUGGUUCCAGCUCUGAGACAGCUUUCAGAGUACUCCUCCUCCUGUUCCCACAUUCACAUCCCUAGGGGACUCUCUCCUCCCAGCGUGUCUGUUCCCCCGCAUGCCCCCCACGCUCUGCUCCCCUGGCACCUCUGCCAUGCUGCUGCCCCAGGGCAGAUGUGGCCAAGGGGCUCCUCUCCUCCCACUCCUCGUUUGCUCCAGGAUCAAGGACACACUUCUUGGCCCAUUGAAGGCCCUUCCGGAUCCACUUCCUUAGCCUAGGCUCUAGCUUCUCCCUGCUUGCAGCCAUGCAGCAGGAGGCUCUCUUUAUUCCUCUUUGCCUGUGAAGAUAGCUGCCUCUGGCAGGAAUACCCUUUGCUGCCUCAUCUGCCUGGUCAACUCCUAUCCCCCAUUUCAGAUUUUGCCCAAGACUUUCUAAGACAGUAGAAGAAAGGUUUCCACUCCUUUCCCCUCCUGAAAACUGUACAGAAACCACAGGAGAACAGGAAUAGAAGCCUGAACUCCGUCUUUGGUGGAACAUGGAGACCUCCCUACUCUUGAAUCUCAAUACGUGGAGGGGGAAGCUGCUGGAGGAGGAUAAAGCGCUCAGCAGAGAGGAGAAACAUCAAACCUCUGUACUUACCAGUGGGGAAGGCACUAUAGAAAUGAGCUGAUUUUCUCUACAGAGACCCAGAAAGGGUCCAGGAUCAGAGGCACCAGGUAUCACAGGAAGUGGGGCAGGACCUGAGAAUAGGGGUAGGGGGUAGUUUGAAAGUCUGUGUAAGGAGCAGUAGACUUCCAAGUCCCACUCCAUCCUAUGCAGCCAGGUGACUGUCCUCCUUACUCCCACGAGAGACCAGAGGUCCUGGUCUCAGAGAUGCCAAGUGUGAAGAGAAGGGGUGAGGUGUCCUAAUAAAGGCUCCCAGCCUCCUUCCCCACCCACCUCCAGGGUACCAGAAUCAGGCUUAUGCCUGCAUCCUGCACUAACCCCAUGCAAAGAUUGAAGUGUGUUUUCACUGGAGGAAUUAAACAAGCCCAAAGAAAUGACUGACAGAUGCUUAUGCUCAGGGGUCUGUAGCAGAUAAGCUGGUGGGAGCAACUGAGUGUCCAAUUAACAUGCCACACUCAGGCACUUCAUACCUCCAACUGGCCCUGCAGUGGGGAACCAUUAAAUACCAACACACACCCAAAGAUCACGGACACUUGAGGGACACUUUCUCUCAGUAUUCUGAGGAAGAUAUGAACCAAGAGGAAA

Taxonomic tree

View annotations in different species by clicking on species names.

Scroll around to explore the entire tree. Click tree nodes to collapse or expand them. Hover over taxon names to display additional information.

Publications