v24

Sorry, there was a problem loading sequence from server. Please try again and contact us if the problem persists.

Homo sapiens (human) coronary artery disease region linked MFGE8 regulatory lncRNA URS0000EF06D6_9606

Caution, this is an AI generated summary based on literature. This may have errors, see here for more. Please share your feedback with us.

CARMAL: CARMAL is a lncRNA that plays a role in cellular function and localization [PMC7311772]. It is not expected to have a major role in ribosomal maturation [PMC7311772]. However, the absence of CARMAL may affect the function of SBDS protein through changes in post-translational modifications [PMC7311772]. Additional factors are likely to be involved in the perturbation of local chromatin by CRISPRi effectors targeting CARMAL [PMC7311772]. A minimal level of CARMAL is needed for the expression of MFGE8, suggesting a functional link between CARMAL and MFGE8 suppression under basal conditions [PMC7311772]. Deletion of CARMAL affects the expression levels of gene neighbors, but the mechanisms require further clarification [PMC7311772]. The deletion also results in changes in the abundance of several transcripts, with a slight bias toward upregulation [PMC7311772]. The introduction or deletion of CARMAL does not significantly affect MFGE8 or ABHD2 levels, suggesting that its transcript is not necessary for their regulation [PMC7311772]. The functional aspects and genome-wide roles of CARMAL are still being explored through various experiments and analyses [PMC7311772].\

Genome locations

Gene Ontology annotations

Sequence

Sequence features are shown above as colored rectangles. Zoom in and click to view details, or Reset

Search for similar sequences 
GCCCACGUUGCAGAAUCAUGAGCAAAUAUGUUGUGGAUUGGCUGUAACUCUGCUCUGGGAUCCAGGCUGAAGGAGCAGGCUCUAUCUGGAACAUUACUAGUCUCCAGGCAGAAGAAAAAGAGACAAUGGAAUGGAUGAUUGAAUGGAUGAAUGAACUCCACAGGAAGAUGAGGAAAGCCUUUAUGGAUGGAGUGAGCUUGCAGCAGAGUCUCAAAGGGGGGCCUGGCCACCAGAGUCCCAAGCUACCAAGAUGUCAAGUAAAGAAGAACUGAAAGCCAACUGCUGGAUGCAGCAGUGAGUGGGGGUCACAGUGGCCUUUGCCAGAACUGUUCCAGUGGAGGAGUAGAGGAAGAGAGAAAACCACAGGAGCAGGCAUCGCAAGCUCAUGCUCCACCCACACGUCCCCUUUCUCCUUUAGUCCUGUGACCCAUGUGCUUGCUCUCUUUCUCUCUCAAAGGAGAUCCAAAUUUAAAAAUAUGGAGCCAAGGGAAUCAGUUCCUUUGCGAACACACUGAACGUUAGUUUUCUUCUUCUCUUUUGCAAAAACUUCUUAUUUCACAAAAUACUCAAACAAAUAGACAAAGUACAGUGAAGUCCAGGUAGAUAUCAUCCACCUUCAGCAAUGAUCAAUCCAUGGCCAAUCUUUCAUCUCAACACUCGUAUCCUCAUUCUUGUGGAGCAAAUGCCAGACAUUCUUUCAUCCAUCAGUAUGUCAAUAUGUAUCUCUGAAAUAGAAGGACUUUUUAUAAAACAUAAUCAUAAUAUAAUUAAUAUUCAUUCCCCAAUUGUUUUGUUAUUGUCUUUUACAGUUUAAUUUUUGUUUUGUUUUGUUUCGUUUCUUUUUGAGACAGGAUCUUGCUCUGUUACCCAGGCUGGAGUGCAGUGGUGCGAUCAUGACCCAUUGCAGCCUCUACCUCCUGGGCUCAGGUGAUCUUCCCACCUCAGCCUCCCAAGUAGCUGGGACUACAGGUGCAUGCCACCAUGUCCAGCUACUUUUUUGUAUUUUUGUAGAGAUGAGGUCUCACCAUGUUGCCCAGGCCAGUCUCAAACUCCUGGGCUCAAGUGAUCCACUUGCCCCAGCCUUCCAAAGUGCUAGGAUUACAGGCAUGAUCCAUAAUACCCAGCUACGGUUUGUUUUCAUUUGGAUGCUAAUAAGACCCAUACAUUCCAUUUGGUUGAUCUAUCUCUUCAAUUUCUUUUAAAUUUAUAAUUUUAUAAGGUCCCCUUCCACAUUUUUCUUUGUGGAAGAGGAGAAAAGACCCUUGUUCUCUGGAUCACUCUGUGGUUAAGGGGGUAGGUCCUCAAAUCAGAUGCCCUGGUUCUAUUUUGCUUUCUUGUUUUUUAGUACUUUUUGUUUGUUACCUACACACAGAAAAGUACAUGAAUCAUAAGUGAGCAGCUUGAUGAAUUUUCAUAAGUGAACACACCUGUGUAACCACCACCCAGCUCAGGAACAGGGCAUCACUGGCACCCAAGAACCCCCUCUCAGGCCCUUUCCCAGUCUCUACCACCUCACAAAGGUCAGGUGACUUUUUCACACCACAGCCAUGUGUUACCU

Taxonomic tree

View annotations in different species by clicking on species names.

Scroll around to explore the entire tree. Click tree nodes to collapse or expand them. Hover over taxon names to display additional information.

Publications