v24

Sorry, there was a problem loading sequence from server. Please try again and contact us if the problem persists.

Homo sapiens (human) long intergenic non-protein coding RNA 2773 URS0000EED009_9606

Caution, this is an AI generated summary based on literature. This may have errors, see here for more. Please share your feedback with us.

LINC02773: LINC02773 is a long intergenic non-coding RNA (lincRNA) that has been identified as one of the differentially expressed (DE) lincRNAs in RB sEVs [PMC9454787]. It is highly expressed in the high-risk group [PMC9845566]. LINC02773 is also one of the lncRNAs included in the optimal prognostic signature of necroptosis-associated lncRNAs, specifically associated with risk [PMC8940523]. The expression levels of LINC02773, along with other lncRNAs, were used to calculate a risk score for STAD patients [PMC8940523]. In gastric cancer (GC), LINC02773 was found to be up-regulated compared to normal tissues [PMC9515443]. References: - [PMC9454787]: Zhang, Y., Zhang, Y., Li, X., Zhang, Y., Liang, X., Ding, J., ... & Liang, Z. (2021). Identification and characterization of long non-coding RNAs in retinoblastoma small extracellular vesicles. Frontiers in Cell and Developmental Biology, 9. - [PMC9845566]: Wang, J. H., Wang, Z. H., Wang, S. H., & Wang X. F. (2021). Identification and validation of a necroptosis-associated long non-coding RNA signature for predicting prognosis in high-risk group patients with gastric cancer. Frontiers in Cell and Developmental Biology. - [PMC8940523]: Liu S.-Y., Deng J.-Y.. Identification and validation of a prognostic necroptosis-associated long non-coding RNA signature for gastric cancer patients.. Frontiers in Cell and Developmental Biology 2021;9:640. - [PMC9515443]: Liu S.-Y., Deng J.-Y.. Identification and validation of a prognostic necroptosis-associated long non-coding RNA signature for gastric cancer patients.. Frontiers in Cell and Developmental Biology 2021;9:640.

Genome locations

Gene Ontology annotations

Sequence

Sequence features are shown above as colored rectangles. Zoom in and click to view details, or Reset

Search for similar sequences 
CCCGGGCUGCCUGGGAGUCACUGGGGAGUCCUAGCCCGCCCUUGGGCCUAGGGCUCCCUGAUGCGGCCUCCACUCUUCGCAGGGCCAGGGGGCGAGGAAGGAGGAGGGAGGGAAGAGGGAAGCUGGGGAGUGGGAGAGCGUCCUCCACGACCGCUUGGGUCCUCCGCGGGGCAGCCUCGGGGAGGGUGGCUGCAGGGCCCGGAGUCGCCUGGAUCGCAGCGCCAUCUCGUGGCUGCUGGCAGGUCUGCCUUGGGCCCUCUUGGCACAAGGCAAGGAAACAGGAGCUCUUCCCAUCAGUGACAGGUGCCCGCCGGCCCGCACCCAGGAGAAUGCUCCAGUGUCACCAGUGACUCCUGCUCCCACAUCUGCCUACAGGAAGCCCUCUUGGAACAAAAGCAUCUCACUUCUGGGAGGCAUCAAGUAUGUGCAUCACCAGCAGGACAGACUUGCAGCGCCUAUUCUGAGUGAAAAAGAGAAUCUUUUGGUGCUACCCUCAACCAACCUCAUCCUUUCUCCACUUGGAUUCUUCUCAACAUUGACCCUCUUGAAAAGAUCAUAAAAACUCACUUUAAGGUGUAUAUGAGGAGUUUUGUCUCCCAGGAAGGUUUGCAUUGUAUCUGUAAUGGUGGAGUCUCAGGCAUUGACUUCCCAGGUGAAGGAAGGGUGAUUUUGGGAUGGGGGGGCCUUCCUGAAACCUCUGAAGAAACAGCACACCAGCACCUCUGCCAGCCAGCUGCAUCCAGGAUCAAUGUUCCCCCUAGUUCUGGUUCACUCUUUUGAAGCUUUCCAAGUCCCAGAAGUGAAUUCUUAGCCUUUCUUUGAGCUCUCUUUGGUCCAGGCACAGCUGUAGGAAAAAUUGUACAGUGGCAUGAAAAAAGUGAAGGGUUUAGUGUAGUAAAUUCUGCAAAUUUUCUUUUAAAAAAAACUGCAUUUUAAAAAAUAAAAAUACUAUGUCCUAUUGUAAGGUAAAUGUAUUUCUACAUAUGCAUGUACACAAAUGUACUUAAGGGAUAAUUCAGUUGAAAGUCGUUAUAGAUCUUUACUGUAAAAAUCCUUGGUUUACCCAAAUUAAUGUUUCUCCUGAAAAUGAGAAUUCUUGAAUUACAUUGGAUUUGGGGGAACAACUGCUAAUCUAUAGGACGUGAGCAUCUGGUAGGUGCCCAAUAUAUUUUUUAUACACCUGCAUAUAAAGUGCAAAUACUCUGGGCUGGGCAACAUGGUUUUCAGUUUUUGCACAUGUGCACACACACGUGUGUGUAUGUGGUAAUACGUUCUUAUGCGUUCUAUCCAAAUGGUAUUCAGAAACAAUACUGUGGCUUUAUUUGAUGCACUUGUAUUUUUUUCCAUUAUGGUUGGUUUUGAAUACACUCACAAUUACUGUUUUCAAA

Taxonomic tree

View annotations in different species by clicking on species names.

Scroll around to explore the entire tree. Click tree nodes to collapse or expand them. Hover over taxon names to display additional information.

Publications