v24

Sorry, there was a problem loading sequence from server. Please try again and contact us if the problem persists.

Homo sapiens (human) long intergenic non-protein coding RNA 1705 (LINC01705) URS0000EEB8A4_9606

Caution, this is an AI generated summary based on literature. This may have errors, see here for more. Please share your feedback with us.

LINC01705: LINC01705 is a long non-coding RNA (lncRNA) that has been implicated in breast cancer. It has been found to be overexpressed in breast cancer cells and tissues [PMC7412980]. Additionally, a negative correlation has been observed between the expression of LINC01705 and miR-186-5p [PMC7412980]. The overexpression of LINC01705 has been shown to promote the proliferation and migration of BT-549 and MCF-7 cells, two breast cancer cell lines [PMC7412980]. These findings suggest that LINC01705 may play a role in the progression of breast cancer by influencing cell proliferation and migration. Further research is needed to fully understand the mechanisms by which LINC01705 exerts its effects in breast cancer. The identification of lncRNAs like LINC01705 as potential biomarkers or therapeutic targets may have implications for the diagnosis and treatment of breast cancer [PMC7412980].

Genome locations

Gene Ontology annotations

Sequence

Sequence features are shown above as colored rectangles. Zoom in and click to view details, or Reset

Search for similar sequences 
AGAGGACAUUUCCCACUUCUACACUCCACAUGGUUUUGGCCUUGCCGGAAGAGGUCACAAAGUGGCUUUGGAAUUCACUCACACAACAUGAGGGUACUUUGCACAGGUAGAGAAUGGUUGAAAUACACACUACCUGAAGCUGGAUAACUCAUGAACUCUGUUGACAAUUAUAUUCUUUGUCUUUUUAAUUAACUCAUUUGGAGUUGGUGUCCUGAGGACCUAAGCCUAAGAAUCUUCAAGAUGGAAGAGUAGAGUGAACAAUGAAUGAGCCAGAGGGCUCUUGUCCUCUGUGUGCAGCUCUGGGCAGCCAGCAGGUGGAUAUGGGACUUGGCCUGCUGGAGGGGCCCUGGCAAGAGGAGCUGGCAGGAGCAGAUGGCAAAGAUCCUUCUACUAUAACCCGGGGAGAUGGAGAACAUCUGUUUGGGGCAUCCUUUUGUUGGAACGACUAACUCUGCCGUAAGGAAAAGGAUGAAAGAUUAGCAUAAAGUUUGCUAAUCAGAGGACAGGCAUUCAUAUCCUGGCUUCACUACUUGUUGUGUGAUCUUAGACAAGUUGCUAAACCAUUCUCUCUGCCUUAGAUUUUUCAUCUGCAAAAUGGUUCUACUCAUGAUACUAAAAUCAUGGUGCCAUUGUGAGCAUUAAGUGAGAUGAUGCAUUGCAAAGCACUUUAACCUAGUUCUUUAAUAAAUGUGAGAUGGAAAGAAAAGGAGAAGUAGAGAAAGAUAAAAAGUUAGAUUACUCUGACAUUGAAAAAUGCAAUUAUUUGAGAACAGAUAAAGUGGGAGACCCUAUUUGGAGAUUUUAGCAAAGAGAGCAAAGAUAGUCAUACAUGUUGGGUUGAAUAAUAAUGUAUCUAUCACACUAUCUUUCACUACGUGUCAUAGUCUAUAUCAUUCUAAAAUUAUCUUGCCCAUUUGUUACUUCCUUAUUGCCUGUCUUUCUCCACUAGAAUGUAAAAUCCUAGAGGGAUGGGCCGUAUCUGUGUCAUUCAUUACUAUACCCCCAGUACCUAGAAGAAUCUUUGGCACAUAGUAAGUAUUCAAUAAAUAAUUGUUCAAUGGAAGAAAAAA

Taxonomic tree

View annotations in different species by clicking on species names.

Scroll around to explore the entire tree. Click tree nodes to collapse or expand them. Hover over taxon names to display additional information.

Publications