v24

Sorry, there was a problem loading sequence from server. Please try again and contact us if the problem persists.

Homo sapiens (human) HORMAD2 and MTMR3 antisense RNA 1 (HORMAD2-AS1) URS0000EEACE2_9606

Caution, this is an AI generated summary based on literature. This may have errors, see here for more. Please share your feedback with us.

HORMAD2-AS1: HORMAD2-AS1 is a long non-coding RNA (lncRNA) that has been identified as closely related to the prognosis of lung squamous cell carcinoma (LUSC) based on bioinformatics analysis [PMC10111779]. In high-risk LUSC patients, HORMAD2-AS1 was found to be highly expressed, while the expression of other m6A-related lncRNAs, including AC138035.1, AC243919.2, and AL122125.1, was downregulated [PMC10111779]. A risk model for LUSC prognosis was constructed using two m6A-related lncRNAs: AL122125.1 and HORMAD2-AS1 [PMC8637334]. In the TCGA-LUSC cohort, six lncRNAs (AL122125.1, AC138035.1, AP001469.3, AC243919.2, HORMAD2-AS1, and PRC1-AS1) were significantly correlated with the survival of LUSC patients [PMC8637334]. The expression of AL122125.1 and HORMAD2-AS1 showed significant differences between LUSC tumor tissues and normal tissues [PMC8637334]. However, there were no studies reporting the prognostic values and biological functions of AL122125.1 and HORMAD2-AS in tumors [PMC8637334]. Further analysis showed that AL122125. 13 m6A-related lncRNAs were identified as prognostic lncRNAs in LUSC patients by univariate Cox regression analysis including HORMAD2-ASl [PMC9641337].

Genome locations

Gene Ontology annotations

Sequence

Sequence features are shown above as colored rectangles. Zoom in and click to view details, or Reset

Search for similar sequences 
AGCAGCCGCCUCUCAGCCACGGGCUGCACACUGACCCGACGCGACCUUCGGUCAGGGGCCGCCAGCCUGGGCCACCUAUACAACGACAGCCUGCUCCGGGGCUUCCUGAGGAGGUGCCUGCCCCGCCGAGGUUCAACAGCUUUGGAGAGCAGGACAUCUUUUCCUCUCAGCCUGGCCCUCUGCAAUGGAGGCCAUAAAUAGGCCAGUAGUGGAAGCUACAGAACACGUGAGCAUGGCAGGGGCUGAGCUCCAUUUCAAGAUAUGGGUAAGAGGAGGGAUGCUGUUGCCUUGGAGCUGCCAGGCUGCAUGGCAGACAAGCAGGAUUCCUGCUGCCUCCCAUGGAGACUAUACUGGAACGCAGGUCUUGCCCUGUCAUCCAGGCUGGAGUGCAAUGGAUCUUGGAUCACUGCAACCUCCACCUUCCAGGCUCAAGUGAUCCUCCUGCCUCAACCUCCCAAGUAGCUGGGACUACAGUUCAAGGAAAGAAGCAAACUUAUUAUUUAAGAGCAAUGCAAAAUGAAAGCCAAGGCCAAGGACUUACUUUCCCGGAUCUGGCAUCUGAGUGCACAGCAACCGCAGAGACUGAAAACUCCUCCGAAUAGAAUGAAUGUUUGCCAUCCCCAUAAACACAACUUCACAGUUUGGGUAAUACUCUGGAGAGAGUAACAAUAAAGAGAACACAAAUACGUUGAACUUAAAGCCCACAUGGCCAAAUUUAAAAGCAAACUGGCUAUAAAACAAACCCACUGCAGCUUCUGAUUAACGAAACUGAAAUGUUUUGAAAUGCUUAACUAUUAGCCCAAUCCUUUAUAAUAAGAGGAACACACUGAAUUUUAGCUAUCUUUUCAAAAAGCGUGAAAAGGGAAGGUUAGAUUUGUAAAGAAGAUACUGACAUAAAAUAAAAGCUAUUAUUUUUUAAAAGAAA

Taxonomic tree

View annotations in different species by clicking on species names.

Scroll around to explore the entire tree. Click tree nodes to collapse or expand them. Hover over taxon names to display additional information.

Publications