Sorry, there was a problem loading sequence from server. Please try again and contact us if the problem persists.

Homo sapiens (human) Gilles de la Tourette syndrome chromosome region, candidate 1 (GTSCR1) URS0000E60ADB_9606

Caution, this is an AI generated summary based on literature. This may have errors, see here for more. Please share your feedback with us.

GTSCR1: GTSCR1 is a non-coding RNA gene that has been identified as a regulatory gene in cardiac inflammation [PMC8207744]. It is upregulated in T2D neutrophils, while other differentially expressed genes in T2D individuals are primarily downregulated and associated with inflammation or lipid metabolism [PMC8207744]. GTSCR1 is one of the 17 lncRNAs obtained from the intersection of 3,760 lncRNAs and 89 lnRNAs screened in correlation analysis [PMC8449535]. Despite its upregulation in T2D neutrophils, the function of GTSCR1 in T2D is still largely unknown due to the limited knowledge about its overall function [PMC8207744]. However, initial investigations suggest that GTSCR1 may have importance in cardiac inflammation [PMC8207744]. Interestingly, GTSCR1 was initially annotated as a protein-coding gene with proteomics evidence but was later annotated as a long non-coding RNA (lncRNA) [PMC4697840]. Overall, while there is evidence of GTSCR1's involvement in cardiac inflammation and its upregulation in T2D neutrophils, further research is needed to fully understand its role and function in T2D.

Genome locations

Gene Ontology annotations

Sequence

Sequence features are shown above as colored rectangles. Zoom in and click to view details, or Reset

Search for similar sequences
CAUUUCAACCUUCCUUUGCUUUUACCCUAUCAUGCUCCCUCACCCCACAAAGCUUUUGUACAUUCUGCAUCUCCUUCCUGGAACAUUCUACCUCCCUCUGCAUCUAGGUCUCUGCCUGAGCUCAGGUUCCCUAAAAAGCCUGGUCUGAGGCAAUGACUAAAAAGGCUCCUAUUUUGUUUAAGGACGUGCAAACUCAUGGCAAGAAGGUGAGGAAAACAGCUACGGAGGGAAGGAUGAGAAGCAAUGCAAAGUGACAUAUACCAUCCUGGCCACAGCUUCCCAAGUUGGGUCCUUUGCUGGGUGCACUCAUGUGGCCAUGAGGGACAUCUCAGAGAGACUGCAGAGAUCAGAAAAACUCAUCAAAAUGGAGACCUGCAAAUAAGAGGAGGAAGAGGGAGGAGAGAGAGCACAGAAAUCUUCCAAGUGGCUUCAGUGACAGAAGGGGAGGAGUCACCACCUGCCAUUUGCAUGGAAGUGUUUUUGUUCCUCUGGUUUAUUGCUCCUAUUUAUGCAUGCGUGUGCAGGAUCUUCAAAAUCCAGGUAAGAAACACAGUGAAGAACUCAUCUACUGCAAGCUUGGCCCCAUCCAUCAGUACCAGUGAAGAGAGACAAAUCAGGAUAGAAAGACAUCACUACCAUCUCUAUGGUCAGUGAUAUUAUGGACUAAUGAAUAAAAAUAACUGCUUUACACAGGA

Taxonomic tree

View annotations in different species by clicking on species names.

Scroll around to explore the entire tree. Click tree nodes to collapse or expand them. Hover over taxon names to display additional information.

Publications