v24

Sorry, there was a problem loading sequence from server. Please try again and contact us if the problem persists.

Homo sapiens (human) CCDC140 long non-coding RNA URS0000DBA68C_9606

Caution, this is an AI generated summary based on literature. This may have errors, see here for more. Please share your feedback with us.

CCDC140: CCDC140 is a primate-specific gene that encodes a protein of unknown function [PMC3669123]. It is associated with regional patterning in non-cortical tissues, such as the hindbrain [PMC7295160]. CCDC140 is one of the five lncRNAs that are predicted to be trans-regulated genes by 30 transcription factors [PMC8976607]. In osteosarcoma, CCDC140 is one of the 10 CNV-lncRNAs significantly associated with 294 coding genes [PMC8976607]. In fibroblasts, CCDC140 is one of the four genes proximal to differentially methylated loci (DMLs) [PMC3580430]. CCDC140 is also linked to long non-coding RNA and neuropeptide NPY in relation to Ki-67 LI [PMC9776514]. The myogenic differentially methylated (DM) sites in the CCDC140 intron and downstream region are located near neural or hypaxial somite enhancers of mouse Pax3, despite the lack of a CCDC140 gene in mice [PMC3669123]. The intragenic sequences of CCDC140 act as PAX3 transcription regulatory elements in muscle lineage and prevent leaky activation of development-specific non-muscle enhancers [PMC3669123]. There are neural-specific and hypaxial somite enhancers within the mouse region similar to the single intron of CCDC140 and downstream region, as well as a second neural enhancer in intron 4 of Pax3 [PMC3669123]. The PAX3/CCDC140 region shows low enrichment in H3K9me3 in muscle lineage cells [PMC3669123].

Genome locations

Gene Ontology annotations

Sequence

Sequence features are shown above as colored rectangles. Zoom in and click to view details, or Reset

Search for similar sequences 
AAGUGUGGGCGCAGCCGGGACAAUUUCGAGACAACUUCGAGACAAUUUCGAAUGGACAAAUUGCGGAGAAGUUGCUUCUGCCGCUCAGAAGCCGGUUCACCUCCUUCUCCACCGCGGCAUUUCCAAAACAACAGGGACAAGUCUCCCCGGCUCGCCGCAGGCCUGACCGCCCAGCUCCGCCAGGAUUUGCAGAGAGCAGCGCGCUCCAUUUGCAGAAAGGAAAUCGAGACUGGACUCCUUCUGACUCCACGCGGCCCCAGCUCCUGAACCAGCGCAGUGAGCCUCAGCCGCUUCUCAAACUGGGUCUCAGAAAAUUUCUCCUCGAGAUGGAUUUCAGCGGCAGGAAAGAGGGGCCAGUGACGCGAGGAGCAAGAAAAGAGUAACAUGGGAGAUGAAUGUUCAAACCCAGAUCUCCUCGCUGAGCCUGGAAGCUCGCCACCGUGGGAUCACGGGAACCAGAGGCAAGAGGCUGCGAAUGAGUCCAACACCCGCGUUCCUCGAGUUUUAAAAGCACACCUGGGGCCAGAGACUGCACAGCCAACUAAACGGAGUAAACGCAACAGGUGGAGGAGGCAGAGUUGUCAGGGGCCAAGCCCGGCGCGAUCUGGCCAGUUCUUGGGGAGCGCGGACCUGGGACUGCAGAGAGGCGUUUUGAAGAGUGCUGCGCGCACCUGCCUCUCGGAGAUAUCCAACUCCACCCGGGCGUCUCCUGAGAGCGCACAGUCCACAGACCCCGGGAGGGCUGCCCGCCCUAGGACACGUACUCUCCCGACCCCUCACUCUUUCAAAAUUGGGGAAGAGGCGGAGGAGAUGAAAAAGAAGAAAGAGAGAAAGAGAAGAAAAGAGAGAAAGAAGGAAAGAAAUUUUAAAAAAUAAUAAAAGGAGGGAAGAAUGGAGGUAAAACGCGGGGGAGAGAAGAGGGGAGAAACUCUCCUCACCACAACCAAAGCAGGAGGCCUAAGCUUCCUGAAUUUCUACACAUGACUUGCAUUAAGUUCCUUCCUAGAACUUAAACUUUUUCAUCUCCCGUCACCCAAGAAAACACCCAUUUCCUCUUUUAAAUAAAGUUUCUUUUUCUGGAGAUGAACCUUUAAAUAAGUCGUACGUUUGGGAGCGAGGGACAGGAGAAUAAUUUUGAUCCAGAACCUUGGAGAUUGGAGAAGCAGGUGGAAAAAUUCUAAAAAGAUGAAAACUGACCAUCUCCGACACAGAAACCCAUCGAAAGGGGCCACCGAGACCCGUUGAUUAGCUGGAGGGAGCAUGCGGCAGAAGUGCAGACCCCUCGCUAACCCGCCAACCUCCAAGAGCCCUCUUGCAGAAAGCUGCCCGGCUCCCCACGGUGGCCCUGCGCGCGCACCAUCCUCGCGGUCUCGCUUCUUCGCCCCGGAAAACUCUAUGAGGGGCACCCCAGCCUCAGCCGGGUUAAGACAAGUAGCCCCAAGAGGAAGGAGCCUCAGAGAGCCUUUCUUCCUGUUCUUCUUCGUCUUCUUUUUUUUCUAAACGAAAUCUAAUACUAUCUGGCUGCAAAAAUAUAUUAUCACCGGCUCUCAGCCUAAGAGACUAACAUUUGGAUAUGUAGGAAAUGUAAUCUGCAUGGCUAAUUGAUUCUCAGCGUAUCAGUUUAAAGGAUAAAGAUCGAUAUCUACAUGAUGGAUAUUGUAUUAAUAGGGGCAUAAAUAAAGGUCGAAGAGUCGUUACC

Taxonomic tree

View annotations in different species by clicking on species names.

Scroll around to explore the entire tree. Click tree nodes to collapse or expand them. Hover over taxon names to display additional information.

Publications