Sorry, there was a problem loading sequence from server. Please try again and contact us if the problem persists.

Homo sapiens (human) long intergenic non-protein coding RNA 595 (LINC00595) URS0000D78019_9606

Caution, this is an AI generated summary based on literature. This may have errors, see here for more. Please share your feedback with us.

LINC00595: LINC00595 is a long noncoding RNA (lncRNA) that has been implicated in various diseases, including thyroid cancer [PMC6089163]. Copy number amplification or deletion of LINC00595 has been observed in thyroid cancer, suggesting that genomic alterations may contribute to its dysregulation [PMC6089163]. LINC00595 has also been identified as a potential marker gene for A. fumigatus and C. albicans infections [PMC5240112]. In the context of lncRNA-miRNA-mRNA and lncRNA-RBP-mRNA networks, LINC00595 is connected to several differentially expressed lncRNAs, miRNAs, and RNA-binding proteins [PMC7880379]. In prostate cancer cells, the expression of LINC00595 was found to be lower in drug-resistant cells compared to non-resistant cells [PMC9162921]. Additionally, LINC00595 is negatively associated with miR-663a-5p expression and exhibits differential expression between normal and inflamed lung tissues [PMC6317664] [PMC9537226]. These findings highlight the potential role of LINC00595 in various diseases and its involvement in complex regulatory networks. Further research is needed to fully understand the functional significance of this lncRNA.

Genome locations

Gene Ontology annotations

Sequence

Sequence features are shown above as colored rectangles. Zoom in and click to view details, or Reset

Search for similar sequences
AAGAGCAAGCUCAGUGUUUCCUUCAAGCAGCAUCGUGGACAGAUUCCUGCCAGACCCUUCAGAGCAAGCACCCCACACCCCUAGCCCAGGGUCUCUUCAUCGAUAGGGGGUGAUCUGUCUGCCCCUCACUGUUUUCUCCAAAUAGAGAUAAGAUCUCACUAUAUUGCCCUGGCUGGUCUCAAACUCCCGUGUUCAAGUCAUCUGCCUGCCUCGACCUCCUAAAGGGCAAGCGGGAUUACAGCCUUCUCCACAGCCCAGCCACAGUGAGGGAGUCAUCAGCACUGGAACCCGGGGUCCACGGCCUUGGAGGAUCCGGACCCUCCGCAUUUGAGGAACUUGGCCUUCAGUCAGGGAGCCAAGAAGUCCCUGCCAAUCAAGGAGGGGGUGUGGGCUGGUGGGGGGGGGGCAGCCUUGGGGCACGGGAGCUGAUAGACCAGACUCAAGAGUUCUACUCCUGACUUCUAGAUUGUUCCACCUCCAUAUGGAAUAUGUUCCUUCCAUCUAACACUGUGUGAUUUGGGGACCAUCCAACUCAAAUGAAAGAAGCCAAGCCAUGCAGCGAGCCACCCCCUCCCCAAUGUGGGGUACCCCCUGCCCCCGCCCAGCUCCCCUGCCCUCCCAGCUGAGGGGGGAUCGCCGCCUGGUGAUCUCAGCCUCCCCUCCAAGUGGGCUGUGAAGUGUCUAAUCCAGGCUUUCAUCUGGCAUCCACAAUUAUAAUGUCAAGAUUGAAUAAUCUGCCUUUAUCUCCCGGGUGACAGCCAUGUAGAAACUUCAAAAGAAACAGUUUUGCUGGCAUCUAACGGCUUUUGUUAAUUACUAUAUCCCAAAGAAAAUGAAAUAAAGGAGGGAGAAAAAUGAUA

Taxonomic tree

View annotations in different species by clicking on species names.

Scroll around to explore the entire tree. Click tree nodes to collapse or expand them. Hover over taxon names to display additional information.

Publications