v24

Sorry, there was a problem loading sequence from server. Please try again and contact us if the problem persists.

Homo sapiens (human) ADARB2 antisense RNA 1 (ADARB2-AS1) URS0000CCE155_9606

Caution, this is an AI generated summary based on literature. This may have errors, see here for more. Please share your feedback with us.

ADARB2-AS1: ADARB2-AS1 is a long non-coding RNA (lncRNA) that has been studied in various diseases, including pancreatic ductal adenocarcinoma (PDAC) and endometrial cancer. In PDAC, ADARB2-AS1 has been found to be associated with the risk of the disease [PMC6549402]. In endometrial cancer, a lncRNA signature that includes ADARB2-AS1 has shown prognostic value [PMC7294624]. ADARB2-AS1 has also been identified as one of the lncRNAs with high accuracy in discriminating between malignant and benign intraductal papillary mucinous neoplasms (IPMNs) [PMC9978013]. Knockdown of ADARB2-AS1 did not significantly affect apoptosis or cell death in certain cell types, but its suppression was associated with decreased cell viability in leukemic cells [PMC8539450]. Additionally, ADARB2-AS1 is one of the node lncRNAs that positively correlates with overall survival in PDAC patients [PMC7971536]. The abundance of ADARB2-AS1 and other lncRNAs was quantified using a custom nCounter™ Expression Assay codeset [PMC5585319]. Overall, these studies highlight the potential role of ADARB2-AS1 as a biomarker and its involvement in various diseases.

Genome locations

Gene Ontology annotations

Sequence

Sequence features are shown above as colored rectangles. Zoom in and click to view details, or Reset

Search for similar sequences 
CUGGGGCCUCACCAGAUGCAGAUGCUGGUGCCACGCUUCCUGUACAGCCUGCAGAGCCAUGGCUGCACAAACCUUUCUUCCUCAUAAAUCACCCAGCCUCGGGUGUUCCUUUCUAGCAACACACACGGACUGAGCCGGAUGACAUGAAGCAGCUGUUCCCGCCUCCUCCUGGCACCUCCCUGACUCACGCACUUGGUGCGUGGAGGGGUCGUGAGCGGGCACAGGCAGCCACUUCGCUGCUUGCCUCAUCAGCCUCACAGUUCCCCACAGCUGUCGAGGAUGCCCUGAUGUCUGUUCUCACAUCACAUUGCGCUCCAAGUACCCCGGCUGCAACCAGAGCUCAGCAAACCGGGACCAGAGGGCACAUCCACCCUGCCUGCCCAUGUCAACAGAGUUGUGUGGGAGCCAGCCGGCCCCCAGGAAGACCCCAGAUCUUCCUGCCCCUGACCACAGCUCUGUCCCUGGAAGCAUAUGCUGCAGACACUUGCUCUGCUGCAGAUUUUCUGCACAACCCCUCCUCAUGGGGGAAGGUUUGGUACCUGAAUGAGGCCUCUUUUGACCUCUAUUCCUAUCACUAUUUUUGGUGACCUCAAUAUUUAUGAAGGUAAUAACUUGGUCUUUAAUCCAGACAAUUUUCACCUCCAGGAAUCUUGUCCUGCAUCUCACUU

Taxonomic tree

View annotations in different species by clicking on species names.

Scroll around to explore the entire tree. Click tree nodes to collapse or expand them. Hover over taxon names to display additional information.

Publications