v24

Sorry, there was a problem loading sequence from server. Please try again and contact us if the problem persists.

Homo sapiens (human) small nucleolar RNA host gene 17 (SNHG17) URS0000CCDFFF_9606

Caution, this is an AI generated summary based on literature. This may have errors, see here for more. Please share your feedback with us.

SNHG17: SNHG17 has been investigated as a functional target for STC2 in rectal cancer cells [PMC8260683]. It has also been studied as a predictive biomarker for gestational diabetes mellitus [PMC7914071]. SNHG17, along with SNHG1, SNHG3, SNHG15, and SNHG25, has been found to have prognostic value in prostate cancer [PMC9296331]. Additionally, a risk assessment model constructed with five FR-DELs including SNHG17 has shown potential as a prognostic signature for renal cancer patients [PMC8804361]. Upstream regulators of SNHG17 include YY1, TGF-β1, STAT3, and two positive feedback loops involving miR-339-5p and STAT5A or FOSL2 [PMC9515549]. Mechanistically, SNHG17 has been shown to facilitate tumor growth and progression through the β-catenin signaling pathway [PMC8063240]. It has also been found to be enriched in extracellular vesicles captured from different cell types [PMC5803193]. Furthermore, SNHG17 can recruit LRPPRC to inhibit c-Myc ubiquitination and promote c-Myc expression and proliferation [PMC9385862]. The role of SNHG17 as an oncogene in hepatocellular carcinoma (HCC) progression suggests its potential as a therapeutic target for HCC treatment [PMC8455207].

Genome locations

Gene Ontology annotations

Sequence

Sequence features are shown above as colored rectangles. Zoom in and click to view details, or Reset

Search for similar sequences 
GUAUUUCCGCCGGCGCGAAACGAGCGUAGCUUCCUUGUCGUGUGGCCUCAGUCCUUCGCCGUCCCUCGCCGUCCUUCGCCAUCGCACGCCACCGCACCCCAUCUCUCGAAAUCUGCAGACAUCUUGAUUUUUCCCACGCUGUCUGUCAGGUCUCCGCCGCCACUCGACGCCAGGGCGCCGGGCCUUGUGGGCUGUGCUGCACCUCGGACGGCUUCGCACCAGCCAGCGCCCUCUCUCUCCUGCAGCACUCUGAUCUGCACCCCCUGAGGGGCUUCCACUGUCCGCGGGGUGAGAAUGCCCCUGGGAGUGUCACAUGACUGCCGCCCCAUGUGUGUGAGAGGCGUCCUCUGGGAGAGCAUGGAUCCUGAGGUCCCAGGAUUGUCAGCUGACCUCUGUCCUGUGUGCCCAGUGGCCCCAGGUGACGUGUCUUCAAGAAGAGGCUGAGCUGCGGUGCUUGUAAGGCAGGGUCUCAUUCUGUCACCCAGGCUGGAGUGCAGUGGUGCAAUGAUGGCUCACUGCAGCCUCGACCUGGGCUCAAGUGAUCCUCCACCUCAGCUUCCUGAGUAGCUGGGACCACAGAGUCAUGUGCUGUUCCUGGGGCUUGGAUGAUGUAGGGGAAGCAAGGUGAAAGUGGUAUCCCGUGGUUCCACGUUCUGUCCUGCUGUGGGGCUGUCCCUCACAUGCUUUCAGUGGCUGUUGCAGAGGAAGAGCCUCCGGAAAUCUGCGUGGGUCUCAGCCUUAGAUCCAAGGACAGUCCAAGGAAGUCCUAAGACCAUGGAGUUGGUGAUCUGGGAUCUGGGUUUGCUGAUAUUUCUCACCGUGAAUCUCUUGGUGGUGUUUGUGGGCACGAGAGGGGCAGAGAAUGGAGAGUGAGGCUACCACAUGAAGCGUCACCAGAGCUGCUCCCUGCUGCCUGCUCAGAGCACCCCGGAUCCACUGUUCAAUCUGCACAAGAUUCGGGGUCCAGACAUGGGAGACUUCAGCUGCCUCAGAGGACCGUGGACAGGGAAGGCCAGCCUCGCAUCCCUCUGUCCAUGCCUGGAAUGACUUUAAUAACCAAGAGUUUUAUUUUUGAAUUUGUAGCUGUCGUUCACUUUUUACCCACCCAUUCAAUAAACCUUACAGAAUUGCUCCA

Taxonomic tree

View annotations in different species by clicking on species names.

Scroll around to explore the entire tree. Click tree nodes to collapse or expand them. Hover over taxon names to display additional information.

Publications