Sorry, there was a problem loading sequence from server. Please try again and contact us if the problem persists.

Homo sapiens (human) LMNTD2 antisense RNA 1 (LMNTD2-AS1) URS0000BC4643_9606

Caution, this is an AI generated summary based on literature. This may have errors, see here for more. Please share your feedback with us.

LMNTD2-AS1: LMNTD2-AS1 is one of the seven candidate long non-coding RNAs (lncRNAs) found to be associated with pulmonary arterial hypertension (PAH) for the first time [PMC9779127]. It is also one of the lncRNAs whose expression data were merged with prognosis data of pancreatic cancer (PC) patients [PMC9632290]. The expression of LMNTD2-AS1 was found to be correlated with several other lncRNAs in PC patients [PMC9632290]. In a risk model for PC patients, high expression levels of LMNTD2-AS1 were associated with a significantly lower progression-free interval (PFI) compared to low expression levels [PMC9632290]. LMNTD2-AS1, along with other lncRNAs, was also found to be significantly correlated with overall survival (OS) and PFI in PC patients [PMC9632290]. The overexpression of LMNTD2-AS1 and other lncRNAs was associated with a shorter OS and PFI in PC patients [PMC9632290]. Furthermore, the overexpression levels of LMNTD2-AS1 and other lncRNAs were found to have significant value in diagnosing 1-, 3-, and 5-year survival time in PC patients [PMC9632290]. In breast cancer, LMNTD2-AS1 was highly expressed compared to normal breast tissue [PMC8521053][PMC9171493][PMC8961446][PMC9035528][PMC10057494]. Its overexpression was associated with poor prognosis for breast cancer patients [PMC9171493]. Additionally, PD-L1 expression was significantly associated with LMNTD2-AS1 expression in breast cancer cells [PMC8521053].

Genome locations

Gene Ontology annotations

Sequence

Sequence features are shown above as colored rectangles. Zoom in and click to view details, or Reset

Search for similar sequences
GUGAGUUCUGGGCCAGCCCAGCCUGGAGGAGGUGUGAGAGGCUGAGCCACUGCUCAGCUUAGCGGGGGGACCACUUAGUGACCAACACCCUGAGGGAGGCCCCAGCAUCCCCUACCUAGCCUGGCAGCAGCAGCGGGAUAAAUAGGGGGGCACUGCUGCCUGUGAGCCAGCCCAGCAUAGCCAUGGGUGUGUGGGGGAAGCAGACAGAGACAGGGUCUUGCUCCGCUGUCCAGGCUGGAAUGCUUCGGUGUGAUGACAGCGCACGUUAACCUCGAAUUCCUGGGCUCAGGUGAUCCUCCCACUUCCGCCUCCUGACUUGCUGAAACUACAGGCACCCGCCUCCACCGCCAGGCCCAGCCCACAGCUCCUUUGACCUCAGUGACAGGCACUCACCUACCUGACCCCCAAACUGAAGCCUCACUUUUCCCAGCCGUGUCCACACCCUCUGGGCUACCCCAUUACCAUGACAAGUAUUCCCUCUGCUCCAGGAGAAAAGCCAGGUCCCAGACCUGACCCAUUAAAACCCAAUCAUUCCA

Taxonomic tree

View annotations in different species by clicking on species names.

Scroll around to explore the entire tree. Click tree nodes to collapse or expand them. Hover over taxon names to display additional information.

Publications