v24

Sorry, there was a problem loading sequence from server. Please try again and contact us if the problem persists.

Homo sapiens (human) long intergenic non-protein coding RNA 1703 (LINC01703) URS0000BC460D_9606

Caution, this is an AI generated summary based on literature. This may have errors, see here for more. Please share your feedback with us.

LINC01703: LINC01703 is a long non-coding RNA (lncRNA) that has been studied in the context of non-small cell lung cancer (NSCLC) malignancy. In a recent study, the role of LINC01703 in NSCLC malignancy was characterized, and the detailed mechanism of action was unraveled [PMC8790138]. It was found that LINC01703 enhances the invasiveness of NSCLC cells by modulating the miR-605-3p/MACC1 pathway [PMC9558288]. LINC01703 is a type of lncRNA, which are RNA molecules that are longer than 200 nucleotides and do not code for proteins [PMC8790138]. In NSCLC, LINC01703 has been found to play a role in promoting malignancy. The study mentioned in the text aimed to understand this role and elucidate the underlying mechanism [PMC8790138]. The study revealed that LINC01703 enhances invasiveness in NSCLC cells by modulating the miR-605-3p/MACC1 pathway [PMC9558288]. Specifically, LINC01703 affects miR-605-3p, which is a microRNA involved in gene regulation. By changing miR-605-3p levels or activity, LINC01703 indirectly affects MACC1 expression or function. MACC1 is known to promote cancer cell invasion and metastasis [PMC9558288]. In conclusion, LINC01703 has been identified as an important player in NSCLC malignancy. It enhances invasiveness by modulating the miR-605-3p/MACC1 pathway. Understanding these mechanisms could potentially lead to new therapeutic strategies for NSCLC treatment.

Genome locations

Gene Ontology annotations

Sequence

Sequence features are shown above as colored rectangles. Zoom in and click to view details, or Reset

Search for similar sequences 
ACGCCCACCGGGUCCGCCCCCACGCGGCCGCCUGCACAGGGGGUUCCAGCCACCCGCGCUCUCCCAGGUUUGCCGACCUUACGGGCCCUUCUCCGCCAGCCCUGGCUGGGUCACCCCCACGACCCGGGACUCCCCCGCCGUUCCCUCCCGGGCUGCCUGCAGUGAGGUCCGCUCCUGAGGCCUCAGCCUCGCCGGGGGUAGGGCCCUCUCCCGCCGUCGCCGCAGCUCCUUUCCGUCCCGGGGCCUGGGGGGCACCGUCCCACGGGUGAGGGCCGCCUCCAGCGCCUGGCCCAGCCAUGCGAACGCCUGGAGCCCGCGAGCUGCAGCUGCGGCCCUGAAGGUGCCGCAUAUCCUGCCGAGUGGGUGAAGCGUGGCACUUUGGAAAACAAAUCGGGUGAUCCGCCCACCUCGGCCUCCCAAAGUGCUGGAAUUACAGGCAUGAACCACGGUGCCCGGCUGACACAAGGAACUUUCUAUGAGGUCCUAGGAAUGAAGGAAAACAGGCAAUAAGGCAAGAAUCGCUGUCGAAGGAGUCUGCGCCACCUGCUCGCACAGCUCACUUGUGCCUUCUGAGCCUGCUGGAGCCCAGUGUACAUAUGCCGUCUCCGCGUGAUUAGAGAUUGCUGCUGCACGUGCCCAAUCCCGUGGCGGGGCUGGAACACAAACGGGGUGGUGUUCCAGCUGCAACCAUGCAGAUGAAGACUAUACCCUAGGAGAUGGAGGAACAACAGACAAGAAAGAAACCUGGGUUCCUGAAUAACCACGUGGAGCCAAGCAGCUUACUUAUCUCAAGCCACUGUUGCCCACCUCCAGAUUGAACUGUCUGCAAACAAAUCUUUACUUGAUGAGAAGUUUAAAUAUAAUUAAAUCUAGAAUAUUACA

Taxonomic tree

View annotations in different species by clicking on species names.

Scroll around to explore the entire tree. Click tree nodes to collapse or expand them. Hover over taxon names to display additional information.

Publications