Sorry, there was a problem loading sequence from server. Please try again and contact us if the problem persists.

Homo sapiens (human) ELF3 antisense RNA 1 (ELF3-AS1) URS0000BC45EE_9606

Caution, this is an AI generated summary based on literature. This may have errors, see here for more. Please share your feedback with us.

ELF3-AS1: ELF3-AS1 is a long non-coding RNA (lncRNA) that has not been investigated for its dysregulated expression and biological significance in glioma [1]. In oral cancer, various lncRNAs, including ELF3-AS1, have been found to be dysregulated and associated with different cellular processes such as proliferation, migration, invasion, apoptosis, and cisplatin cytotoxicity [2]. However, the specific role of ELF3-AS1 in these processes is not mentioned in the given context. References: 1. Zhang Y et al. (2020) Comprehensive analysis of long non-coding RNA expression profiles reveals the potential role of ELF3-AS1 in glioma. PeerJ 8:e10080. doi: 10.7717/peerj.10080. [PMC7519982] 2. Zhang Y et al. (2020) Comprehensive analysis of long non-coding RNA expression profiles reveals potential biomarkers associated with proliferation and metastasis in oral cancer. Cancer Cell Int 20:10. doi: 10.1186/s12935-019-1086-x. [PMC9237953]

Genome locations

Gene Ontology annotations

Sequence

Sequence features are shown above as colored rectangles. Zoom in and click to view details, or Reset

Search for similar sequences
CACGGGGCACUGGCCUGGGCAGGUGGCGGGAACGUUGCUGGGGUGGGCAUCUGUGCUUUCGGCUGCCCUCUGGCCCAGGAAAUUCCUCCCAGGGGCCAGGCCAGAGAUGGGCCAGGCAGGGGGAGGGCAAGUGAGGGAACAUGAACCCCUGGCUGACCUGAGUCAGAAAGCUGCUGGCCCCUAAAUUCCAGAGAUUCAGCAACAAAGAGGCCUAGUAGGGAGAGGAGUUACUAGGUUUAGGGGUUUUUCCCAGAACACCCAGGACUCUGGCCAGGGGCUGGAAGGUGCUCCAGGCUCAAUGCUGGGCAAUACUCAUGGAUUAAUUGGUGCUGGCUGGGCCUGCCAGCCUAGUCGUGGCCCCAGGGUCCCCACUAAAGGGCUCCUUCUCCAGCGCCCACUCUGUUGGCAAGGUCUUCACUACCAUCACCUGCCUGGACUCCAUCCAAGCAUCAGGGUUGCUGCAGUCGCUCCUGAAGAGACCCGGCUCUGCUUGAAAGUUCUUCCCUCAGCGCCUGCUGGAGCCCUCCCUGCCGGAGUUGCCAGAAUCCACACGGAAUCCACAGAUCUGCCCUGAUGAUCAUGAAGGAAUGCGAAAGAGCCUGGUAAAACGAUAUGGACUUGUGCAAAUGCAAAGCAAUGGUGAAGUCAUCACGAACCGCACAGACUGGACAGAACUCCUAUCUGGCUGCAAUGGCUUGGGUUCAGUCAGCCCAGGGGCCAGAGAAUUGGCUACAAAGAGCUCUGGAGUGCCCCUCCCUCCAAAUAAAGUAUUCUAAGCGUGCACUGAUCAACAUGAAGUUCGCAUUAACUUGGGGCUCCAAGCUCAAUUGA

Taxonomic tree

View annotations in different species by clicking on species names.

Scroll around to explore the entire tree. Click tree nodes to collapse or expand them. Hover over taxon names to display additional information.

Publications