v24

Sorry, there was a problem loading sequence from server. Please try again and contact us if the problem persists.

Homo sapiens (human) GPC3 antisense RNA 1 (GPC3-AS1) URS0000BC45AA_9606

Caution, this is an AI generated summary based on literature. This may have errors, see here for more. Please share your feedback with us.

GPC3-AS1: GPC3-AS1 is a long non-coding RNA (lncRNA) that functions as an activator, promoting an increase in euchromatic marks on the GPC3 gene body, thereby increasing its transcription [PMC9905133]. GPC3-AS1 interacts with p300/CBP and is involved in the epigenetic activation of GPC3 in hepatocellular carcinoma (HCC) [PMC9905133]. It has been reported that GPC3-AS1 is upregulated in HCC and is associated with poor prognosis, as well as promoting HCC cell proliferation and metastasis [PMC7325970] [PMC5833433] [PMC8611033]. GPC3-AS1 has been identified as a potential therapeutic target for HCC [PMC5833433]. It has also been found that GPC3-AS1 physically binds to PCAF and recruits PCAF to the GPC3 gene body region, leading to an increase in euchromatic histone marks and activation of GPC3 transcription [PMC8810756]. Additionally, GPC3-AS1 positively regulates its nearby gene, GPC3, to enhance the proliferative and migratory abilities of cervical cancer cells [PMC9256752]. Furthermore, HCC-associated lncRNAs, including GPC3-AS1, have been shown to alter histone acetylation to influence HCC progression [PMC6524221] [PMC5799857]. Overall, these findings highlight the important role of GPC3-AS1 in regulating gene expression and promoting cancer progression.

Genome locations

Gene Ontology annotations

Sequence

Sequence features are shown above as colored rectangles. Zoom in and click to view details, or Reset

Search for similar sequences 
UUUUUUAGUUUAAUCAAGUUGAAAUUUCUUGUUAAAAGGAAUAAAAGAUCCAACUUCAAGCAACCCCCUUGUAUAUAAGGAUACCGUGCUAUUCUGCCUAUAGCAGCAGUCAGGGCAGCAAGGUGUUUUCUUUUCUAUCAGAUUUCAGCAGACUAAUAAAACUCAAAGCCUGAAAAAGGGAGAGAUGAGGUAGUCUCUCCAAACAUGCUCACGUGGAUGGUGCCAGGAAGCCCCUAGGCAAGUAAAAUAACUUCUUUGGAAGCCUCAAAUCACUUUAGCCUCAAAUAAACCUUGACACCCAAGUAGGGGUAUCAGGCAACCCACCAAGGCCAUAUAUAUCUCCGGGUUGCUGUGGAAAAAGAAGGACAGAGUUUCCUAAUCCAGACAUUGAAACACUAAGUGGUACCCUCCCAUUUGUAACCGAUGAGUAUUCACAAGGACAGGUGGGUAAUGGAGGAUGAACAUUCCCUCCCAGCAUU

Taxonomic tree

View annotations in different species by clicking on species names.

Scroll around to explore the entire tree. Click tree nodes to collapse or expand them. Hover over taxon names to display additional information.

Publications