v24

Sorry, there was a problem loading sequence from server. Please try again and contact us if the problem persists.

Homo sapiens (human) DDN and PRKAG1 antisense RNA 1 (DDN-AS1) URS0000BC4562_9606

Caution, this is an AI generated summary based on literature. This may have errors, see here for more. Please share your feedback with us.

DDN-AS1: DDN-AS1 is a long non-coding RNA (lncRNA) that has been reported to be a poor prognosis factor in cervical cancer [PMC9226135]. It is part of a feedback loop involving DDN-AS1, miR-15a, miR-16, and TCF3 that regulates tumor progression [PMC9226135]. DDN-AS1, along with other lncRNAs such as TMPO-AS1, RUSC1-AS1, and DLEU1, has been found to be upregulated in cervical cancer and acts as a promoter in cervical carcinogenesis [PMC9763697]. DDN-AS1 has also been identified as one of the five necrosis-related lncRNAs used to construct a signature that independently predicts cervical cancer prognosis [PMC9763697]. In squamous cell carcinomas such as cervical cancer and laryngeal cancer, DDN-AS1 has been found to play an important role in tumor occurrence [PMC9201629]. In other types of cancers such as urothelial carcinoma (UCC), DDN-AS1 is upregulated and associated with poor prognosis. Knockdown of DDN-AS1 suppresses UCC progression by inhibiting proliferation, migration, and invasion of cancer cells. The increase in DDN-AS1 expression is mediated by the activation of the transcription factor TCF3. Furthermore, DDN-AS1 acts as a competing endogenous RNA (ceRNA) by binding to miR15a/16 and promoting TCF3 expression through a positive feedback loop [PMC8165754]. In various signature models for different cancers including osteosarcoma (OS), AP005436.3 and XX-C2158C12.2 are also identified along with DDN-AS1 as common genes [PMC8037759].

Genome locations

Gene Ontology annotations

Sequence

Sequence features are shown above as colored rectangles. Zoom in and click to view details, or Reset

Search for similar sequences 
GACGGGGCGCUCGCCCCACAGGCGCCAGGCGCUCCGGCCGCAAGGGAGCAGGGAGCCCUGCCAGCUGGGCCACCCGAGGGGCGUUGCGGGGCUCCGGGCGGGGUCGACCCGGGGGGCUCCGUCGGGCCCCACCAGCCUUGCGCCUUUUUCGCUCGGUCUCCUUGGCCUCCCGCUCCUGCGACGCCGCUUUCCUUUUCUCUUGCUCCCGAGCUCGGACCUCGGCCAGGGGCCCCGCCCGCCAGUUGGUCGCCUCCUGCAGCACCCUGGAGGCCCAGGGCCGGCGGGGCGGCGGCUGUGGGGAUCCCGGGCGCGGCCCACACCUGGGACAAUGAGCAGGAACCCAGAGACAGGGUCUUGCUGUGUUGCUGAGCUGGUCUUGAACUCCUGGCCUCCCGCCUCAGUCUCCCAAAGUGCUGGGAUUACAGGGAAUGUGACUUCACUGGACGCAGUAUAAAGAUCUUCAGAUGUCCUCCUGCCGGGGAUUGCAGGGAUCACAGAAAGACCAUCGAGGUCCAGGAGCUACCUGCAAGCGGAGAUCCCUCUGGACGCCCCGUGCCUCACCCAGCAAAGCCGGCUCACAACCCUGCGCUCUCAAACCUCUAAAAGGGCUUGAGGUGCCAAUAGGAAAGGAGGCCCGAGAUUGCCACGGCAUACGUGGGCCCCAAGGAGGGAGCCAGGAGUCACUGCCUGCUUGGGCUAAGGGUACCGCGUACGGAAAGGCGGCGGGGACGCGGCCCAGUUCCAGGAGAUGCGCCCAACGAAGAAGCGGAGGAACAGGGUCACGGGAUAGGGCAGACACCCGGCUGCUUUUUGUUUGCUAGACACCAGCGCCAGCCCCUGCCCGGCCCUCCCGGUCUCCUAAGGGUUGGGGGGGUGUCUUAGGCUCCACAGCGCCCCCGACCGCCCUCCUGCACUCCUCACCGUCUCCAUUGCAAGAGGCGCCCGGCUUGGUUUCCUCGCUUUAGGAAACUCUCUUGGGGCAGGCCCCGCCCCACAUCCGGUGCGGCGACGCCACUUCCGCCCACGUCAUGGCAGUCGCCAGACUGGGGCGGAAGGCAAGGAACCCACCCUUCCGGCGGUGGCGGGCCUCGGUAACCGCCCUCCCCCGGGUCCUCGCGGACCGCACGGAUCCGGCUGACGGCGAGGGUCAUGGGACGGAGCCGCUUGUAUUUAAAAUGUUCUUUUUUUAUUUGUCGUUUAAAAACAAACUUGGAAGAAGCAAAAUCCAAAACUUGCCCUUUGCCUCUCGCAACAUAAAUAUGUACAGUUCAGAAUGAUCGCUGAUACAAAACAUGCCAAGGACAGGGGCGCUGAGGGUGGAGGGAGAGAGGGCGCUUUAAAAAAGGGAACCAUUUCAUCCGUUGUUACGAAGGACCAACCUUGCUGUACAGGAUACACACAACACAAAAUAAAGUCUUCACGGGAUUCAC

Taxonomic tree

View annotations in different species by clicking on species names.

Scroll around to explore the entire tree. Click tree nodes to collapse or expand them. Hover over taxon names to display additional information.

Publications