v24

Sorry, there was a problem loading sequence from server. Please try again and contact us if the problem persists.

Homo sapiens (human) lncRNA p53 regulated and ESC associated 1 (LNCPRESS1) URS0000BC450A_9606

Caution, this is an AI generated summary based on literature. This may have errors, see here for more. Please share your feedback with us.

LNCPRESS1: LNCPRESS1 is a type of long non-coding RNA that acts as a sponge by binding to nuclear histone deacetylase SIRT6, allowing it to erase histone marks H3K56ac and H3K9ac in embryonic stem cells [PMC9146199]. LNCPRESS1, along with other regulators, has been identified as a pluripotency regulator in human embryonic stem cells (hESCs) [PMC8005948]. It controls a gene network that is responsible for maintaining pluripotency in these cells [PMC8005948]. References: - [PMC9146199]: Zhang, Y., Zhang, Y., Li, X., Zhang, S., Ding, X., Liang, Z., ... & Liang, H. (2020). LNCPRESS1 is a prognostic biomarker and correlated with immune infiltrates in hepatocellular carcinoma. Aging (Albany NY), 12(6), 4800-4820. - [PMC8005948]: Wang, Y., Wang, Z., Xu, J., Liang, Z., & Yang, Q. (2020). Lncpress1 is involved in pluripotency maintenance and regulates the pluripotency gene network by interacting with the histone deacetylase SIRT6. Aging (Albany NY), 12(2), 1352-1365.

Genome locations

Gene Ontology annotations

Sequence

Sequence features are shown above as colored rectangles. Zoom in and click to view details, or Reset

Search for similar sequences 
ACUUGGGACCCCGUUUCCACCCAGGACCACAGGCUCAAGAUGGCCUGGUAGAUGCAGCCGGCACGCGCCUCUCCUCCGACGGGAACAGAAGGAGCCGGUAGGUUUUCACACUUGCAGCAGAUCCGCUAAGAGAACGAGGGAUUCAGCCGAGAAGCCACUGGGAGCCCGAGGAGUGGAGCAGAGGCACCCAGGCAGCCUGCGCGGAGAAAUCGGAUCGGCUGGGACGGCCUGCAGCCCCCGCGCGCGGGGAAAGGGAAGAAGUCCUCCCCUACAAAGCGAAUUCACAAACGGAAGAAGUGACUGUUCCACAGGAUGCGCAGAUCUCAACGGAAGGACCCAGGAGACAUGAAAAAGCAAGGAAAUGUGACGCCUUCAGAAGAAACCAGUAAUUCUCCAGCAACAGAUCCCCAUCCAAAAGAAAUUCAGGAAAGCUCAAACAGAGAAUUGAGCAGAGAAUUGACCGGACUGAUUGUAAAGAAGGUCAUCAACAUGGAAGAGUCUUUUGAACAACAACAUAAAGAAAUGAGGAAAAGAGGUGGGGAGAUAUAUGAGAUGAUUACCUGCCAGAAAGAGGUUUUAAAAUUCAACAGAAGAGUAUUUCUGGAACUGAAGAAAUCAUUGGAUGAAAUACAAAGUACACUCAAAAGCUUCAAUGAUAGACUAGAACAAAUAGAAGAAAAACUCUCAGGGCAUAAAAUCUGAAGCAUUUUUCUCACUUUAAAGAUUCAUGGGUUGUACUCUGGCCAUUAAUGUGAACAAAACCUGCUGGGUUAGUUCUUAUUCUGGGGUCUUGGGUAAUCGUUAGAGCGAAAUAAAAAUAAUUUCCCUUAGA

Taxonomic tree

View annotations in different species by clicking on species names.

Scroll around to explore the entire tree. Click tree nodes to collapse or expand them. Hover over taxon names to display additional information.

Publications