v24

Sorry, there was a problem loading sequence from server. Please try again and contact us if the problem persists.

Homo sapiens (human) long intergenic non-protein coding RNA 2569 (LINC02569) URS0000BC44FD_9606

Caution, this is an AI generated summary based on literature. This may have errors, see here for more. Please share your feedback with us.

LINC02569: LINC02569 is an enhancer-derived long non-coding RNA (elncRNA) that plays a crucial role in the progression of intervertebral disc degeneration (IDD) by activating the NF-κB signaling pathway [PMC8802762]. Knockdown of LINC02569 in nucleus pulposus cells (NPCs) resulted in a down-regulation of the phosphorylated P65/total P65 ratio, indicating a suppression of inflammation [PMC8802762]. The expression of LINC02569 was higher in degenerative nucleus pulposus (NP) tissues compared to annulus fibrosus tissues, suggesting its importance in NP composition [PMC8802762]. Suppression of LINC02569 reduced the expression of senescence-associated secretory phenotype (SASP) genes, such as P16, P21, and P53, leading to alleviation of senescence [PMC8802762]. Additionally, knockdown of LINC02569 attenuated NP degeneration by blocking the NF-κB signaling pathway and reversing IL-1β-induced inflammation and extracellular matrix degradation [PMC8802762]. The expression level of LINC02569 was positively correlated with senescence-related genes in NP tissues [PMC8802762]. RNA sequence analysis revealed that key genes and target genes involved in the NF-κB pathway were downregulated upon knockdown of LINC02569, suggesting its potential association with this signaling pathway [PMC8802762]. Furthermore, using a cationic polymer brush-modified carbon nanotube-based siRNA delivery platform enhanced transfection efficiency and reduced potential toxicity when delivering si-02569 to NPCs [PMC8802762]. Overall, these findings highlight the importance of LINC02569 as a potential therapeutic target for suppressing inflammation-induced NP degeneration and senescence in IDD.

Genome locations

Gene Ontology annotations

Sequence

Sequence features are shown above as colored rectangles. Zoom in and click to view details, or Reset

Search for similar sequences 
AGAACGACCGAGUUUCUCUCAGCCGAGAACUGUGGCUGCCCCUCCGGUGAAAACAGAGGAAGUGGGAGCGGCAGGAAGCGCUUUGGGACCAGGGCGACCCCUGAAGCGUAGAGGAACCAGGUCACAAGCAUACGUGAAUGCUCACAUUCCAUAGUUAUCAAAUGUAUUCAGGUUUAAAUUUUACUUUUCUAGAAAAAAUGUAAAUAAUCCGUUGAGAAUAUUUAAUGAAAAAUGUUGGUCGUAUCUUUAUCUGGUCUGCGGCUCUGUCCCUGUUUCCUGGAUAGGAGACUACGUCUGUAUCUUGUAUCACAGGAGGCACCUUCUUCCUGUUUCCUGGCACAGACUUUAAAUCUUAGUGCUCCUCACUCUUUGCGUCUACGCUGCUUUUAUGAACUGUUAACACUCACUGUGAAGGUCUGCAGCUUCACUCCUUAAGCCAGCGAGACCACAAACCCACUGGGAGGGAUAAACAACUCCAGACGGGAGGAACAAACAACUUCGGGUGCACCACCUUUAUGAACUGUAGCACUCACUGUGAAGGUCUGCAGCUUCACUCCUGAGGCCAGCAAGACCACGAACCCACCAGAAGGAACGAACAACUCCAGAUAUGCCACCUUUAAGGGCUAUAACACUCACCGCGGAAGUCUGCAGCUUCACUCCUGAAGUCAGUGAGACCAUGAACCCACCAGAAGGAAGAAACUCUGGACACAUCUGAACAUCUGAAGGAACAAACUCUGGACACACCAUCUUUAAGAACUGUAACACUCACCGCGAGGGUACACGGCUUCAUUCUUGAAGUCAGCGAGACUAAGAACCCAACAAUUCCGGACACAGCAUGAUCUUGGUUCACUACAACCUGGAUCUCCCAGAGUCAAGCAAUCCUCUCGUCUCAGUCUCCCAAGUAGCUGGAACUACAGGUGUGUGCCACCAUGCCCCACUAAUUUUUGUAUUUAUUGUAGAGACGGUUUCAGCAUGUUGCCCAGGCUGGUCUCCAACUCCUGGACUCAAGUGAUCCUCUCCACCUAGGCCUCCCACAGUGCUGGGAUUACAGGAAUGAGCCACCACGCCCGGCCUAAUUGGAAGUUUUAGAGUGCAGUGGGGAUCACGUGCGUAGAGGUUACUGCUGCCUUAAUUAAAGGAGACAACAUGUUUCAUAAAACUUGGAAAUUGUAGAGGGUGUGGGGAACCACUCAAAUUCAGAAUAUCAAAACAGA

Taxonomic tree

View annotations in different species by clicking on species names.

Scroll around to explore the entire tree. Click tree nodes to collapse or expand them. Hover over taxon names to display additional information.

Publications