v24

Sorry, there was a problem loading sequence from server. Please try again and contact us if the problem persists.

Homo sapiens (human) long intergenic non-protein coding RNA 2550 (LINC02550) URS0000BC44DA_9606

Caution, this is an AI generated summary based on literature. This may have errors, see here for more. Please share your feedback with us.

LINC02550: LINC02550 is a long non-coding RNA (lncRNA) that has been associated with poor prognosis in colorectal cancer (CRC) patients [Huang and Pan, 2019; Hou et al., 2020; Yu et al., 2020; Xu et al., 2021a; Li et al., 2021; Li et al., 2022]. In a study on thyroid carcinoma, LINC02550 was found to increase the risk and was significantly positively correlated with poor outcomes in patients [PMC6931392]. However, LINC02550 was also found to be a downregulated gene in thyroid carcinoma, while the other six genes studied had opposite functions [PMC6931392]. Additionally, LINC02550 was identified as one of the 90 lncRNAs associated with prognosis in a study on hepatocellular carcinoma (HCC) [PMC9277109]. In HCC, LINC02550 was highly expressed and enriched in the cytokines and cytokine_sensors molecular pathways [PMC8650115]. Overall, these findings suggest that LINC02550 may play a role in cancer progression and could serve as a potential prognostic marker. However, further research is needed to fully understand its mechanisms of action and its potential as a therapeutic target.

Genome locations

Gene Ontology annotations

Sequence

Sequence features are shown above as colored rectangles. Zoom in and click to view details, or Reset

Search for similar sequences 
CAUUUGCAGCGGGGAGGAGCCUGUUCCUGUGUGGCGACCUGGGCUUCAAUCUGUGAGGCGGGAAACCUGCUAGCAGGACUCUUGCUUUGUGGUCUCCUGUGAGAAGAACAUACCCCAGGUAGCCUCUUCUUUGAGAAGCACAAGGAAACACGUGGUGGUGGAACUGAACACAACCCACAGCCUGGAGCUAAACCCAACCUAAGCCAGCCAAGCUCUUCCAAGAUCACCCAAACUCAAGUUGACCUGUAGAUCCAUGGGCAAGGAAAGAAAUGCCUGCUGUUUUAAGAUCUCAAGUUUUAGGUUGAUUUGUUAUGCAGCAUUAUUGCAGUAAAAAUGAACUAAUACACUACCUAAUCCCAUUUUUCUAUUCAACAGUUAUUUGUUGGGUAGCUGAUAUGUGCCACACACUUAUAAUACAGGCUUCAGGGAUACCAUGGUUAAUAAAAUAAAGAGGGCAAAAGUAAAUGAA

Taxonomic tree

View annotations in different species by clicking on species names.

Scroll around to explore the entire tree. Click tree nodes to collapse or expand them. Hover over taxon names to display additional information.

Publications