v24

Sorry, there was a problem loading sequence from server. Please try again and contact us if the problem persists.

Homo sapiens (human) long intergenic non-protein coding RNA 2257 (LINC02257) URS0000BC4493_9606

Caution, this is an AI generated summary based on literature. This may have errors, see here for more. Please share your feedback with us.

LINC02257: LINC02257 is a long non-coding RNA (lncRNA) that has been identified as one of the nine nrlncRNAs that can be used to predict prognosis in colon cancer patients. Among these nine lncRNAs, MYOSLID, AC006111.2, AC245100.5, AL161729.4, and AL355312.2 were identified as risk factors, while AL137782.1, NSMCE1-DT, LINC02257, and LINC00513 were found to be protective factors [PMC9527116]. Since colon cancer is strongly associated with microsatellite instability (MSI), tumor microenvironment (TME), and other immunotherapy-related factors, further investigation is needed to understand the relationship between LINC02257 expression and immunotherapy-related analysis in cancer [PMC8121256]. In a study analyzing the association between LINC02257 expression and tumor mutational burden (TMB) in 33 cancers using Spearman correlation analysis [PMC8121256], it was found that high expression of LINC02257 was associated with shorter overall survival (OS) and disease-specific survival (DSS) time in colorectal cancer patients [PMC9482534]. These findings suggest that LINC02257 may serve as a potential prognostic marker for colon cancer patients and further research is needed to explore its role in immunotherapy response [PMC9527116][PMC8121256][PMC9482534].

Genome locations

Gene Ontology annotations

Sequence

Sequence features are shown above as colored rectangles. Zoom in and click to view details, or Reset

Search for similar sequences 
AGAUGCACAUGAAAUUUGGUGCCGUGACUCGGAUUGGGGGACCUCCCUUGGGAGAUCAAUCCCCUGUACUCCUGUUCUUUGCUCCGUGAGAAAGAUCCACCUAUGACCCUCAGGUCCUCAGACCGACUAGCCCAAGGAACAUCUCACCAAUUUUAAAUCAGGUGGAGUCUCGCACUGUCAUCCUGGCUGGAAUGCAGUGGUGCAAGCCGACUCACUGCAACCUCUGCCUCUUGGGUUCAAGUGAUUCUCCUGCUUCAGCCUCCUGAUUUGCUGGGAUUGCAGAGCAAACCAGUGAAAAAAUGGCCUUCGCACUCCUGAGAGACCUUUCACCGGGCUUUCUACUUUUGAAUUCUCUCCAUAGCUGGUUUCCUCUUAGGCCUCGAUAGAGCAGUCCCUGAAUCACACAGGUAUGCUGACUACGUCUUUUCCUGGUACAAACCAUCAUGGGGGAAACACACAGCAAGAAGCAUCUUCAGGUCACAAGAUAGGUAAUACCAUCUACCUGAAUUUUUUCAAAAGCAGCAGAAUAUUUAGUUUUCUAUUUCAGUGGCUUCUAACAGAGAUCAUUGUUUGCACAAGAUUAAAUGUCUGCAGUGGUCGUCUUAAAAAAAAA

Taxonomic tree

View annotations in different species by clicking on species names.

Scroll around to explore the entire tree. Click tree nodes to collapse or expand them. Hover over taxon names to display additional information.

Publications