v24

Sorry, there was a problem loading sequence from server. Please try again and contact us if the problem persists.

Homo sapiens (human) ATXN2 antisense RNA (ATXN2-AS) URS0000BC43ED_9606

Caution, this is an AI generated summary based on literature. This may have errors, see here for more. Please share your feedback with us.

ATXN2-AS: ATXN2-AS is a natural antisense transcript (NATs) encoded by the ATXN2-AS gene, which is located in the ATXN2 locus [PMC8279897]. Mutations in ATXN2-AS have been associated with aberrant processing of transcripts in patients with a 9bp-dup [PMC8279897]. The expanded form of ATXN2-AS (expATXN2-AS) is expressed in lymphoblasts of patients with amyotrophic lateral sclerosis (ALS) and has been shown to trigger toxicity [PMC8300638]. The CAG repeats in ATXN2-AS form RNA foci that induce apoptosis and have been associated with ALS risk [PMC7140545] [PMC7041250]. The expansion of ATXN2-AS has also been shown to induce neurotoxicity in cortical neurons [PMC7041250]. It has been proposed that the expansion disrupts the function of ATXN2-AS, which does not seem to affect the expression of the sense RNA [PMC8508793]. The expression of both normal and expanded forms of ATXN2-AS has been detected in ALS lymphoblastoid lines and shown to trigger toxicity independently from protein translation [PMC8508793] [PMC6260474]. Additionally, the presence of ATXN2-AS has been associated with neurotoxicity and ALS progression [PMC8391852]. Further investigation is needed to fully understand the role of ATXN2-AS in spinocerebellar ataxia type 2 (SCA) [Reference needed].

Genome locations

Gene Ontology annotations

Sequence

Sequence features are shown above as colored rectangles. Zoom in and click to view details, or Reset

Search for similar sequences 
GCGGCCGCUGAGCGCAUCGGAGGGCGGGCGCGCCGAGGCGCCGGGUGGGAGCGGAGCAUCUUCACUUCUGCGGGGACCUAGUUUGCCCCCACCUGAUGCAACCCAGAAAAUGGACUGACUGCGAGUGCCUUGGGGCGGAGAAUGUGUCUUGCUACGUGUAAAGCACCUAGAACCCUGCCAGAUUCAGGGGACACAGCAUCCUGCCGUUUUCCUGCCGUCCCCCGCCCGCCACACAGUAGGCGCUCCAGUGGCUCGGGGCAUCUACCAGGCAGGCCGCGCUGUCCUGCCCUGCCGGGGCUGGAGUGGAGCAACCCUCCGGGGCCACCCACAUCUGGGUACCUUUUCCCCACUUUUUCCACCCCAGCCGCGCACAGUCACCAGAAAACUCUUUUAGGUAUCUGACCUUCAUUUGAACCUAUGUUCCCUCACUUGAACUUCUUUUUCCUCAUUCAUGAGAUUCUAAAGGAAAUAUAUGGGAUUGGGA

Taxonomic tree

View annotations in different species by clicking on species names.

Scroll around to explore the entire tree. Click tree nodes to collapse or expand them. Hover over taxon names to display additional information.

Publications