v24

Sorry, there was a problem loading sequence from server. Please try again and contact us if the problem persists.

Homo sapiens (human) HLA complex group 15 (HCG15) URS0000ABD815_9606

Caution, this is an AI generated summary based on literature. This may have errors, see here for more. Please share your feedback with us.

HCG15: HCG15 is a long non-coding RNA (lncRNA) that has been studied in various contexts [PMC7183103]. In glioma cells, stable knockdown of PABPC5 was achieved through cotransfection with HCG15 knockdown or overexpression [PMC7183103]. The lncRNA HCG15 was found to have the highest area under the curve (AUC) value in a study [PMC8551195]. Nascent RNA experiments showed that there were no significant changes in nascent ZNF331 mRNA levels when comparing different groups, including HCG15 knockdown or overexpression groups [PMC7183103]. In the context of myocardial infarction models, EV-associated HCG15 lncRNA, along with miR-153-3p and miR-328-3p, were found to exacerbate ischemic injury through various mechanisms involving NFκB/p65 and p38 activation, PI3K/Akt deactivation, and caspase-3 activation [PMC9373807]. To investigate the involvement of HCG15 in myocardial cell injury, three different siRNAs targeting lncRNA HCG15 were transfected into AC16 cells [PMC8551195].

Genome locations

Gene Ontology annotations

Sequence

Sequence features are shown above as colored rectangles. Zoom in and click to view details, or Reset

Search for similar sequences 
AUCUCGGCUCACUGCAAGCUCUGCAUCCUGGGUUCACGCCAUUCUCCUGUUUCAGCCUCCAGGUAGCUGGGCCUACCGGCGCCCGCCACCACGCCCGGCUAAUUUUUUGUAUUUUUAGUAGAGACGGGGUUUCACCGUGUUAGCCAGGAUGGUCUCGAUCUCCUGACCUGGUGAUCCGCCCGCCUCGGCCUCCCAAAGUGCUGAGAUUACAGGCGUGAGCUACCGCGCCCCGCCAAUUUACCGUGCAGGAUUGCAAACACCAGAGAGAAAAUCAGUCUCUGGAAUGAUGCCUUUGAUGGACCAAGAUGCAGCUGAUGAAGCAUUGAACCAAUUAGCACCUAGCAGGAGGGCACCCUUGCUCUGUGUCCUUGAAGGUUAAAGCUGUCAAAAAGUGGUCUCCCUCAAGUUCGGCCAUCUUGCUCUCAGAGAUCUAGAACUGGACUCAGUCAAAAUUUUGGGCCAAGGAGACCGACGCGCUGUCGCCUGCACUAAGAGAAACGCAACGAACAACUUUGUCAAUGCAUUGCAUUAUACUAUAGCAGCAACUAUACUUUUAAAUGAUUCGAAUCUUGAGGUUUCAAACUGAACCGUCUUGUGCCUUUUGCCCGGCGGGCAUUUCUGCGGGGACCGCGGGUCACCUUCUGAAUUUUUACCUUCAUAAACAGCAAGGACUGCGCUCUUUCGCACGGCGCCCCGUUUUUUCGUAG

Taxonomic tree

View annotations in different species by clicking on species names.

Scroll around to explore the entire tree. Click tree nodes to collapse or expand them. Hover over taxon names to display additional information.

Publications