v24

Sorry, there was a problem loading sequence from server. Please try again and contact us if the problem persists.

Homo sapiens (human) KIRREL1 intronic transcript 1 (KIRREL1-IT1) URS0000ABD7E1_9606

Caution, this is an AI generated summary based on literature. This may have errors, see here for more. Please share your feedback with us.

KIRREL1-IT1: KIRREL1-IT1 is a long non-coding RNA (lncRNA) that has been implicated in angiogenesis and prognosis of colorectal cancer [PMC9019982]. While AC008760.1 has been identified as a potential predictor of poor prognosis in colorectal cancer, the roles of KIRREL1-IT1, AC005625.1, AC018809.1, AC008760.1, and AC083862.2 in angiogenesis have not been extensively studied [PMC9019982]. Survival curve analysis revealed that higher expression levels of AC005625.1, AC018809.1, AC008760.1, and AC083862.2 were associated with longer survival time, while the expression levels of KIRREL1-IT1 were associated with a shorter survival time [PMC9019982]. In a forest map analysis, all sARLNRs (except KIRREL-ITL) were considered protective factors [PMC9019982]. Furthermore, KIRREL1-IT1 along with other lncRNAs (AC005625.1, AC018809.1, AC008760.1, and AC083862) were used to establish the ARRSM model [PMC9019982]. The expression levels of KIRREL1-IT1 decreased as the disease stage advanced while the expression levels of other lncRNAs increased [PMC9019982]. The risk score was found to be associated with increased mortality rate and higher expression levels of KIRREL1-IT1 but decreased expression levels for other lncRNAs [PMC9019982]. Finally, 10 ARLNRs including KIRREL-ITL were identified as relevant to overall survival in bladder urothelial carcinoma patients [PMC9019982]. Additionally, the expression level of KIRREL1-IT1 was found to be elevated in advanced T-stage, while AC008760.1 expression decreased [PMC9019982].

Genome locations

Gene Ontology annotations

Sequence

Sequence features are shown above as colored rectangles. Zoom in and click to view details, or Reset

Search for similar sequences 
AAGAAGGAAAAGUCCAGAAGGAAAAACAGCCAGAGAAAGAAGAGAGAGAGGAGAGAAGAUAAACAGAGCAAGACGAGGCCAGGCGGGAAGAGAUGCAGCCAAGAGCAGCACCGAAGAGGAGAAGCAGAGGCCAGAGGGCCUGGAGCAGGUGAGAAAACCAGAAAGAAGUAGUCUCAUACCUGGAAUUUCAUCCAGUAGCUGGAGUACCUGUCCUAUGUGGUAGAGGCUGUCCAGCCAUGCACCCCCUCUCUGGAUUUGGUACCCAGAGUCAAGAUCCCCAGGAGUAGGUGUGAGUGCUGACUCAUGUUGCACUGAACAUCCCAUCAUCAAAUCCCAGCUCCAUCUGCUCAUCCUGGUCCAAAGUGGACGAUAAUCCCAUUGUUAAGACAUGUCUCAUUAAGACUUCUCUAAGAUGGAGCCAGCAAACAGCCCAGUAGCAUCGAGGCUGCUGCCUGGGAAAGAGUCCCCUCCUCUCCCCUGUUCAUUAAUGAUUAUGGGAGGUUUUAUUCCCCCCAACAAAAGUGUUAAUUAGACAUCAUCGGAACAGGGAUAUUACACAAAUGAAUUAAACUCAAACCAAUCAACAAGCUGGCUCUGUGCUUCAGGUCCCCCGAACGAAAAGGGAAUUGAAGGCUGUAAUGGGAAACAAACGGUAAGAUGUCUUUCCUAAUAUCAAAUAAUAACUAGGAAGGCUGCCUUUGCUUCUAGAACUUGUCUUCUUAUUCUUUUCUUUCUCCCCUCCACUAAACACACACACGCGCGUGCACACACACACAUGCACACACACGCACUGCCAUGAGGCUUGGAGAGUUAGGGUUCCAUUCUUGUGACUGAAACUGAAACUGGCUGGGACUGCCCAGUGGUACUUCUCAGGUGCCCUCUAGGCUCAGGGGCCAAGUGGGAUGGAAGGAGUCAGAAGAGCCCAGUUCCAGUCCCUCUCUGUCACUCACCACCUUCCUCAUCAGAGAAUAGUGUGUGUAAUGCUCAGGAGUUCACAGGGAUGCAGUAGGUACUCAAUACUUACCUGCUGUGUCCAAAUGGCUGGGCGACUUCUGGAAGCAUUCUGUGCCCUGGCAGCAAAUUCCUGAGGCUGAUUGACCCCUGUGGGGAGAGUGGGAAGAACUGGAGGGAAAAGAGUUUUAGUCCUUGUAUUUUGAGGGAUCCCAGUUGCUUGGAGGGAUAGAUAAAGAAGAUUGAAAAGUCUUCUAAAAAUGGACAGAUGAAGCCAGUGCAAUGGCUCAUACCUGUAAUCCCAGCACUUUGGGAGGCAGAGGCAGGAGGAGCACUUGACCCCCAAAAUUUGAGACUAGCCUGGGCAACAGGGUUAGAAACCAUUUCUACAAAAGAAAAACAAUUAGCCUGGUGUGGUGGUGCAUACCCUUGGCCCCAGCUACUUGAGAGGCCAAGGUGGAAGGAUUGCUUGAGCCUAGGUGGCUGAGCCUGCGGCUGUGAUCACACAACUGCACUCCAGCCUGGGCAACAGAGCCAGAUCCUAUAAAUGAGAAAAAGAAAAGAAAAG

Taxonomic tree

View annotations in different species by clicking on species names.

Scroll around to explore the entire tree. Click tree nodes to collapse or expand them. Hover over taxon names to display additional information.

Publications