v24

Sorry, there was a problem loading sequence from server. Please try again and contact us if the problem persists.

Homo sapiens (human) lncRNA in non-homologous end joining pathway 1 (LINP1) URS0000A76D17_9606

Caution, this is an AI generated summary based on literature. This may have errors, see here for more. Please share your feedback with us.

LINP1: LINP1 is a long non-coding RNA (lncRNA) that facilitates the interaction between Ku80 and DNA-PKcs, as demonstrated in previous studies [PMC8866460]. In the absence of scaRNA2, an abnormal DNA-PK complex is formed, which also contains elevated levels of LINP1 [PMC8866460]. This abnormal complex formation has been observed both in the current study and in previous research [PMC8866460]. TGF-β signaling has been shown to decrease the expression of miR-9 [PMC7072809]. In lung cancer cells, LINP1 functions as a tumor suppressor by inhibiting EMT-related migration, invasion, and stemness [PMC6216035]. This suggests that the effects of LINP1 on tumor progression may vary depending on the context of tumor cells [PMC6216035]. Overexpression of p53 has been found to inhibit migration of breast cancer cells by partly decreasing LINP1 expression [PMC6165837].

Genome locations

Gene Ontology annotations

Sequence

Sequence features are shown above as colored rectangles. Zoom in and click to view details, or Reset

Search for similar sequences 
CCCUCCGUCUCCUUGACUCUGGGUGGGCUGUGUGACUUUUCCUUGCUCAAUAGAAUGAGAAGGAGGUGGCGCACCGGCUACAAGGCUAGACCGGGGGCUCGCAUAUCUCCACUUGCAGCUGCCACUGCCAUUAGAAGAACUUGCUCAGCCAGCUCCUGGGCCCCAGGAAAAGGACAAGUGUCACCCAGAACAGAGCCACCUCCAGCUGCACUCAGCUCCAGAAGCUGGCCCAGCCGGUCCAGUACACCUUUUAAAUAAUGUCCUCUACGUGCCGGUGUGGAAGUAGCCCGGAUGCAAUUGAAUGAACAACAGACGGUGCUUUCCAGGACGGCGCUGUGCUUUCCAGGAUGGUGCUGUGCUUUCAUUCAUUUGGGUAGCUCCUCUGUGAGCCUCCCAGCGCCGACUGCAGAGCCCCCACUCUCCAGCCUGCAAGACCCCGAAAUUCAAGCCACACAAAGAAAGGAGGAGGGGGCCGUUGGCAUUUACUGAACCUUAUAAAACUGUCAGCAAAACAGCCCUUAGGCUUGGACUCCCUGCUAGCCGGGUUUUACGGUGCUGAAGUCAGCAUCUUGAUUCAGCUGCAUAAAUAAUCUCCUGCAGUCCUGCAAGGCCUGGGGUAGGAGAGGGUAUGGGGACCAGGGCACUCUGUAAGGGCUGGGAUAGGAACCCCAGGGAAUAAGACAGACCAACUGCGGGACUUCAGACUCCACUGCAGCCGGGAUCGGGUUGUUGUUAAUUUCUUAAGCAAUUUCUAAAUUCUGUAUUGACUCUCUCAUGCAUGUAACUGAUCCUUAGAUAUUGUCAGCCAAAUGACUAAAGGAUUUAGAAAUAAAAAAAA

Taxonomic tree

View annotations in different species by clicking on species names.

Scroll around to explore the entire tree. Click tree nodes to collapse or expand them. Hover over taxon names to display additional information.

Publications