Sorry, there was a problem loading sequence from server. Please try again and contact us if the problem persists.

Homo sapiens (human) HLA complex group 24 (HCG24) URS0000A76B5C_9606

Caution, this is an AI generated summary based on literature. This may have errors, see here for more. Please share your feedback with us.

HCG24: HCG24 is a gene located on chromosome 6 within a 200 kb window [PMC10016042]. It is part of a region that also contains other genes such as HLA-DPA1, HLA-DPB1, HLA-DPB2 (pseudogene), COL11A2, HSD17B8, MIR219A1, RING1, RXRB, and SLC39A7 [PMC10016042]. Several single nucleotide polymorphisms (SNPs) within this region have been identified to have minimal linkage disequilibrium with previously identified effects [PMC9778564]. Specifically, rs371143509, rs2844503, and rs6902067 are located within or flanking MHC class I polypeptide-related sequence B (MICB), while rs112394499 is a non-coding transcript variant within HCG24 [PMC9778564]. In a study examining histological differences at HCG24 in mice ovaries with altered gene expression patterns, no difference in the number of hemorrhagic follicles was observed at the HCG24 time point [PMC5429765]. However, ovaries with altered gene expression patterns had visibly more unruptured follicles containing entrapped oocytes compared to control ovaries [PMC5429765]. The change in endothelin peptide had only a minor impact on serum progesterone concentration following ovulation at the HCG24 time point [PMC5429765]. No differences in serum hormone concentrations of progesterone or other hormones were observed at hCG12 or HCG24 hours [PMC5429765]. Follicle counting was performed on ovaries from the altered gene expression group to quantify differences in corpus luteum (CL) and other ovarian structures present at the HCG24 time point after serial sectioning and histological staining with hematoxylin and eosin [PMC5429765].

Genome locations

Gene Ontology annotations

Sequence

Sequence features are shown above as colored rectangles. Zoom in and click to view details, or Reset

Search for similar sequences
AUUGCAAUGGCCACUGUGCGCCAGACCCCAAGGAGAAAAUGAGGCGGCGCAGGGACGGAGGAGCUCCGAAUCCAGCACUCCUUUCCCUACCCCUGUCCAGGGAGAAAGGCUGGAGAUGAAACAGCCUGAUGGGGCUCAACCAACCAGAAUACAUCAGAAGGGACGCCUCUGUGGCUGGGGAAGGAAGAUGCUAGAGCUGCUGGGAGGAAGUGGGAGAAUUGUCAGGCACCAGCAUGGCCCAGGAAGCCCCUGACUACUGCAGAGUGUAGGGCAGCAAGGAGUGGGACCAUUACUCCUGGCGUUCCCAGAUGGAACAGACACCAAGCCUGGCUUUGCCACUGAACACAAUACAGGACUGAUAAAGGAAAUAGAGGCUGCCCAUCUCUCAGUGCCACAUAUGAGAAAGGGAAGUUGUCAUUUUAUAUAUCCACUGUCAAGCAUCUUGGUAAAACAGAAGAAAGCAGGCUGGGCCUGGUGGCUCAUGCCUAUAAUCCCAGCACUUUGGGAGGCCAAGGAGGGCAGAUAGCUUGACCAGCAUGGGCAACAUGGCAAAAUCCUGUCUCUACAAAAAAAUAAAAAAAAACAAAAAAUAAAUGUAGUCCCAGGUACUGAGGAAGCUGAGGCAGGAGGAACACUUGAGCCUGGGAGGUAAAGGCUUCAGUGAGCCGUGAUAAUGCCACUGCACUCCAGCCUAGACAACAGAGUGAGACCCUGUCUCAAGAAAAAGAAAAACAAGAGGGAGGCAAUCUACUUUAUACCCAGAGAAUUUUACAUGCAAGGAAUUUGACUAUGAAUAAGCCUCCAUUGCUUAAGAGAGACUUCACUAUUUGGGAUUUUAAGAAAGAAAUACACAAACAAGCAAAUCUCAUCAGCAGAGGACUGAGAAACCAGUGUUUAUAAUACCCAGUGAUUAAUGUAAUAUUGUCUUCAGUCAUCAUUAAAAGGGACUUAGUUUAAAAGUCAUUUCGAUUGAUCGCCAACUCAGAGUCCUCAACAUUUCACCUUUUGCUUUAUGAAAAGAACUAGUAGAUUAAUUUAGAGUUUGACAAGGAGAAGCAGGUCUCCCUUGAUUUUCUGUUUGGCCAAGAAUUUAUCCUAACAUGGUACCAUCAGAAUACUGUCAGAAAGCUGUGAGUCAACUCAGAUUUCUCACCAUUGAGUCAAGCCGUGAAGCCAGCUGUCUUGGGGGUAAGGAUUUCCAUACAGAAACACUGUAAGUAAAUAAUUUAGCACUUGUUUCCUAUUCCUUUUUAUUGGAUAACUACAGAGAAUUAAAACUGUGGGUUGUUUUGAAUUCACAAAAGAAAUGUUUUAAAGCUUUCGAGGAAAAAGCCAGAUUAUCCAUUGCAAAGCAUCGAAAUUCAAAAUCAUGUUAAGGCUAUAGAGAAAUAGGAUCCUAUCCCCACCUAGUGGCCAACACUGAAAUCUGGGCUUAGAACAGGAAACAAGGGAAUUUGUCAACAAUUUGGGAAUACUCCAGCAUUCUUUACAAAAAAAAGUUAGAGAAAAAGUUAAGCACACAAAAAACACAAGUCAAAAUAAAUACGACCAAAUACAUAGGUUUUGGCAGCACAUAGAUUUCUGUGGUUUUGCUAUGCUUUUAGCAGCGGCUGUAAAAAGCAUUGCACACUAAGCAUUGCUAGAUUGCCAAACAAACCUAAUUACAUUUUUUGUUUGGUUUUUUGUUUUUUUCAAAACCUCCUAACCUCUGUGACCUAAUUAUGUUUUUAAUGAGUUGAUUGUAAAAACUAACAUCAGCGAAUACAAAAUUUCAGUUAGACAGGAGGAAUAAAUUCAAGAUAUGUACUGUACAACAUGGUGACUCUAGUUAAUAACAAUGUACUGUGUACUUGAAUAUUGCUAAGUGAAUAAUUUUAAGUGUUCUCACCCAACACAAAAAAUAUGUAAGGUAAUGCACAUAUUAAUUAGCUUGAUUUAGCCAUUAAACAAUGUGUGUGUGUGUGU

Taxonomic tree

View annotations in different species by clicking on species names.

Scroll around to explore the entire tree. Click tree nodes to collapse or expand them. Hover over taxon names to display additional information.

Publications