v24

Sorry, there was a problem loading sequence from server. Please try again and contact us if the problem persists.

Homo sapiens (human) lncRNA bladder and prostate cancer suppressor, hnRNPK interacting (LNC-LBCS) URS0000A76871_9606

Caution, this is an AI generated summary based on literature. This may have errors, see here for more. Please share your feedback with us.

LNC-LBCS: LNC-LBCS is a long noncoding RNA (lncRNA) that has been found to play a role in inhibiting cancer progression in castrated prostate cancer and bladder cancer stem cells (BCSCs) [PMC9091194] [PMC8814626]. It is significantly downregulated in castration-resistant prostate cancer (CRPC) cell lines and tissues [PMC6585145]. LNC-LBCS has been shown to interact with hnRNPK and AR mRNA to inhibit AR translation efficiency in prostate cancer research [PMC9091194]. It also inhibits the self-renewal and chemotherapy resistance of BCSCs through the epigenetic silencing of SOX2 [PMC8814626]. LNC-LBCS is associated with the downregulation of SOX2 expression, which is critical for stemness maintenance, tumor initiation, and chemoresistance of BCSCs [PMC9617388] [PMC9915130]. It forms complexes with hnRNPK and EZH2, acting as a scaffold to induce complex formation that inhibits SOX2 transcription by regulating H3K27me3 trimethylation [PMC8371405] [PMC9915130]. LNC-LBCS also recruits hnRNPK-EZH2 complex to the SOX2 promoter, suppressing SOX2 expression by mediating histone H3 lysine 27 trimethylation (H3K27me3) in bladder cancer cells [PMC8058412] [PMC9263750]. Furthermore, LNC-LBCS has been associated with good prognosis in castration-resistant prostate cancer (CRPC) and can interact with hnRNPK to inhibit the activation of AR signaling pathway. It also attenuates bladder cancer initiation and chemoresistance by guiding hnRNPK-EZH2 complex to the SOX2 promoter and mediating H3K27me3 trimethylation [PMC8253982] [PMC6682530] [PMC8187453].

Genome locations

Gene Ontology annotations

Sequence

Sequence features are shown above as colored rectangles. Zoom in and click to view details, or Reset

Search for similar sequences 
AGCCCGCACAAUGACUUCCAGCUGGAGCAGCCCAGCCAGCCUGCGCGCUCACUCGCUUGCUUGCGCUGGGCUUCAGGGCGCCCGGGAAUUUGCACUGUCUGUUAAAACGCGGUCAUUGUUUUGCUUUCAAAUCGAACUUCACGACAGUUAGCAACUUCAAGAACGCUUCCAAAUGGAUAAAUCUUUCCAGAAGAUUUCUUGCUUCAAAACAGCUGCAUUUUUGGAAGAAAGUCCACAACUGACAACUAAGCAAAACCCUCCUGGUGGAUAGCAUAAAUCUGCUUUGUUGAAGCUGCUCAUUUGUCUGAUCUAUGAGUCCAGAAGAUGCAAACUCCCUUCCCAGCUUAUGCAAAAAUACUUCCAGUAAAAACAAGCCCUUUGGCCCUUUUCUUUUGUCAGUCCAGAUUUCAGCAUGUUCUUCGCUUUGUUAUUCAUCAUUUUAUGUAUUUGGACCCAUCCUCAAACAGACUUUAAACCGUUUAAAGGCAAGGAGGGACUCUUUCGUAAACCUUUAAUCCCCUGGCCCAGCUGAGUAGAUGCACAGUGUCUUUUGAUGAUGGUGAUAUGGAAUGAUUAAUAACCACACAAGGCAUUCGGUUGGUCAAGUCACUGUUUAUUGGCUCAAAAUAAUCCUUGGUUUCUGUAUGUCUACAGCUCACUUCCUAAACAGUUAAAUCCGGAGAAGUCUAAUAGAUAAUAGUUGGUGAUCAUAAAUAUAAAUAACCAAUACAUUAGAAUGUGUAGUCAAAAUAGGAAUACUUGCUUUUCACUUACUUCCCACGGGUCGCUGCUGGUGGUAGUCAACACAAAUAAAAAUUUGAACUCAUUUUGUUAUUCAUCUAAAAUGAGAAACUCGGUGAAACAUUGAUUUUCUAAAAUUGCUGCAUAUUUAAAUGUGAUUAUAAUUGCUUUUUAGCAUUUUAAAAUUGUAACAUCGAUACCAAAUGCUUAAGAAUCUAAAGAAUAGUCUAUUGGGGCUGGCCUAUUUUGUGUAAAAUGGUCUGUAUCAUAAUGGAUGACUGAUUAUCCCAUCCACAUUAUUUGGAUUCACUUAAUACUAGGUUUUAACGUUAGGAGAAUAAAACCCUCAAGAAACCUAACAUAGAUUUGUAUAUUUAGUUUUCUCCUUCCUUAUCAUCUUCCACCAGACUUACAGGUGUUCCACCUGCUUGUAGUUUCGGUAAUAAUACCAGCUGGCGGUGGUUCCUAACUCUAGCUACACUUUAAAAUUACCUCGUGCAUUUAAAAAAAAAAUGCAGUUGUUUAGGUUCUUCCCCUAGAUAUUUUAAUUUACAAGGUUUGGGAUGUGGCCUGGGCACCGAUUUUUUUAACUUUUUAUUUGAAUGUAGACUUACAGGAAGUUGCAAAGAUAGUACAGAGAGGUCUGAUAGAGCCUCCACUGUUGGUUACAUCCCGCAUAGCUAGAGCACAAUAAUAAAGCCAGGACAUUGACACUGAGAUAAAAUGUGCCUGUGAUUCUGUGUCACCUUAUCCCUGAAGACUCUUGUAAUCAUUACCACAAUCAAAAUACAAACUAUUUCAACACCACGAAGAUCUCUCUCAUACAGUCCCUUUAUGGUCGUCCCUUUCUUUCCCCCACACCAUCCCUAACCCUUUGCAACCAUCAGUCUGUUCUCCAUUUCUAUAAUUUUGUCGUUUGGGGAAUGUUUUAUAAAUUGGUCCUCACAGCUUGUGACCUUCUAAGAUUAGCUCACCAUCCCCCCCACCCCCCCACCCCACCCAACUCAGCAGAAUGCCCUAGAGAUUUAUCCAAGUUAUUGCAGGUAUUUCUAGUUUGUUCCUUUCUGUUACUGAGUUCUACACUAUGGGUGUAACACAGUUUGUUUAAUCAUUCAGCAUUCACCUAUCAUACAUUUUGGUUCCUUCUUUUUUUGGGCGGGGGGAGUGCCUAUUACAAAUAAAACUGUCUUGAAAAAUUG

Taxonomic tree

View annotations in different species by clicking on species names.

Scroll around to explore the entire tree. Click tree nodes to collapse or expand them. Hover over taxon names to display additional information.

Publications