v24

Sorry, there was a problem loading sequence from server. Please try again and contact us if the problem persists.

Homo sapiens (human) long intergenic non-protein coding RNA 841 (LINC00841) URS0000A766AF_9606

Caution, this is an AI generated summary based on literature. This may have errors, see here for more. Please share your feedback with us.

LINC00841: LINC00841 is a long non-coding RNA (lncRNA) gene that has been associated with risk of coronary artery disease (CAD) in certain ethnic groups [PMC7940190]. One specific single nucleotide variant (SNV), rs1870634, located downstream of LINC00841, has been strongly linked to CAD risk and is more prevalent in CAD patients [PMC7261909]. In a study using Caco-2 cells, LINC00841 was found to be the only upregulated lncRNA gene after infection with ΔspeG [PMC4827826]. The LINC00841 gene region has also been associated with myocardial infarction in individuals of European ancestry and showed significance in African Americans as well, suggesting its role in conferring risk for coronary heart disease (CHD) across ethnic groups [PMC6315411]. Variants in the LINC00841 gene have been consistently associated with myocardial infarction and CHD [PMC6315411]. Additionally, LINC00841 was one of the top differentially methylated loci during the classification process for CHD [PMC4684329]. In summary, LINC00841 is a lncRNA gene that has been linked to CAD risk and myocardial infarction across different ethnic groups. Variants within this gene have shown associations with CAD susceptibility and CHD. The upregulation of LINC00841 after infection suggests its potential role in disease progression. Additionally, differential methylation at this locus further supports its involvement in CHD.

Genome locations

Gene Ontology annotations

Sequence

Sequence features are shown above as colored rectangles. Zoom in and click to view details, or Reset

Search for similar sequences 
AGGGUGGCAUAGACGGCGAGCCCAGGGAGGCCACUGACAUGCAUUCAAGAGAAAAGAAAAGAAGCCAGGCUUUGGCAUAAGUGCUUCAUGGUGGAGUGAGAAUGGCUUGCCCUGGAAGGGUCAUGUUUUAGAAGGAGUGAUCUUCAUUGUGAAGUCUAAACUGUUCUGGAAAUAUAAGCUUUGAAACCCAGACACUAAAGUAAAAGAACCAUCAACACAAGUGACAUGUCAUAGCAGGAGCUGACACAGCCUCACCAGCCCAUGCUCGGCCAGACUAGGGAGCAUCGGCCGCUUGUUCCAUCCUGUGCUUGUCUGCCUGCCUCUCUGUCAUGAGACGCAUUCGAAGAGUCCUGGGCCCAAAAGCAACUCACAGUCCAGGAAGACGUCCAGGCCUUGGGUGACGCUCAGUCUCAGUAAAUGGCCCUGGCUGGCAGGUGGUGGUGGGAGGGACCCAGGAAGACAGCAAAUUACUUUACCCUACAAUUAAAGGAUCAGACAGCCAUUUGGAACAGUUGUGCUUACACUGACCACUACCAGCAGCCCAAUCGCUCCUUUCAUCAGAAUGCACAGCUGGCCUUGUGCCACCAAGAUCCCCUGCGGACAAGACCAGAAUUAAAGCAUGUGGAUGAUCCGAACAACACAAGAAUAAGCUAGAAUGUGAAGCAGAGUCAAUCUUAUCAGUUAAUAAAGUCAAGUUGUUGAUUCAGAGAAGAUUGGCCCUGAGAGGAUUUCAGGAGCAGCAGUGUCAUCAGAGCCGAGGCUUCAUUUGUGGUUGUUACCACAAACUCUUGGCUGAACCCAGAGGUGGACAAGAUUUGGGUUAUAGGAAGACUUUGAGGCCAGAGCACAGUGACAUUGGAGGGAGCCGCAACCCUCCCUGGGUUGAAGGAACUAAGGAGGCUCUGGGCCACAGCCUCAGAUGCAGAAACAGCAGCAGCAGCCCCACAGGCUGAGGAACCAAAUCCCUGCUUGAGGCCAAACCCCUGCAA

Taxonomic tree

View annotations in different species by clicking on species names.

Scroll around to explore the entire tree. Click tree nodes to collapse or expand them. Hover over taxon names to display additional information.

Publications