Sorry, there was a problem loading sequence from server. Please try again and contact us if the problem persists.

Homo sapiens (human) DXZ4 associated non-coding transcript 2, distal (DANT2) URS00008E39C7_9606

Caution, this is an AI generated summary based on literature. This may have errors, see here for more. Please share your feedback with us.

DANT2: DANT2 is a long non-coding RNA (lncRNA) expressed from the active X chromosome [PMC9588035]. In a study, DANT2 was identified as one of the hub genes in an immune-related ceRNA sub-network based on E6 splicing [PMC9796994]. Another study found that DANT2, along with LINC01711 and LINC00922, was significantly upregulated in ovarian cancer tissues and correlated with poor prognosis [PMC8194245]. However, the expression of DANT2 was inconsistent across different ovarian cancer cell lines [PMC8194245]. In human X chromosome inactivation (XCI), DANT2 is transcribed from the DXZ4 locus along with DANT1 [PMC8662614]. In breast cancer cells, treatment with PTS resulted in hypermethylation and silencing of the DANT2 enhancer [PMC9793217]. The enhancer activity of the DANT2 promoter has been previously characterized [PMC6088404]. Additionally, DANT2 has been identified as a putative oncogene and is associated with Xi-biased bindings of certain transcription factors on the inactive X chromosome [PMC8388921] [PMC5114649]. Overall, DANT2 is an lncRNA expressed from the active X chromosome that has been implicated in immune-related ceRNA networks, ovarian cancer prognosis, breast cancer gene silencing, and Xi-biased transcription factor bindings on the inactive X chromosome.

Genome locations

Gene Ontology annotations

Sequence

Sequence features are shown above as colored rectangles. Zoom in and click to view details, or Reset

Search for similar sequences
GGAGACACAGAAGAUGGAGGGAGGGAUGGCAGCCUACCCUGUGGCAACGCGGGAGUCGCGUUGCCGCAGGGGGCGCAUUGGGGUCCAGCCGUCCCCAGAACGCAGAUCAGAGGUAGUCGGACCUUUCCCGCUGGCGCGCAGCCUCAGCUAGGUGAGAGGCGUCUUCCCAAGACCAGACACUGCCGGUGCCCUGUCACCUCCCACUUUUUUUCUGGAACUGCUAGGGGCCCAGCGCUGCUUCUGCAGCCUUCCAGGGGAUGCUGCUGGUGGCGCGUAUGCCGCCUAGGUGGGUGGGGAUGUGCUGAGGCCGAAGGAGUGACAGCGACUCGCAGGUUU

Taxonomic tree

View annotations in different species by clicking on species names.

Scroll around to explore the entire tree. Click tree nodes to collapse or expand them. Hover over taxon names to display additional information.

Publications