v24

Sorry, there was a problem loading sequence from server. Please try again and contact us if the problem persists.

Homo sapiens (human) long intergenic non-protein coding RNA 1456 (LINC01456) URS00008E399F_9606

Caution, this is an AI generated summary based on literature. This may have errors, see here for more. Please share your feedback with us.

LINC01456: LINC01456 is a long non-coding RNA (lncRNA) that has been identified as one of the top upregulated lncRNAs in various studies [PMC10074629]. It has been found to be associated with the pathogenesis and prognosis of cancer, including ovarian cancer [PMC6901675]. In a study on breast cancer (BRCA) patients, LINC01456 was one of the seven lncRNAs used to construct a prognostic risk prediction model [PMC6901675]. The expression level of LINC01456 was found to be positively correlated with GNGT1 expression [PMC6901675]. In another study on ovarian serous carcinoma, LINC01456 was included in a signature along with other protein-coding mRNA transcripts and miRNAs for potential risk stratification of patients [PMC8227049]. References: - [PMC10074629]: https://www.ncbi.nlm.nih.gov/pmc/articles/PMC10074629/ - [PMC6901675]: https://www.ncbi.nlm.nih.gov/pmc/articles/PMC6901675/ - [PMC8227049]: https://www.ncbi.nlm.nih.gov/pmc/articles/PMC8227049/

Genome locations

Gene Ontology annotations

Sequence

Sequence features are shown above as colored rectangles. Zoom in and click to view details, or Reset

Search for similar sequences 
CCGAGCCAGGUGUGGGAUAUAAUCUCGUGGUGCGCCAUUUUUCAAGCCCGUCAGAAAAGCGCAGUAUUCGGGUGGGAGUGACCCGAUUUUCCAGGAGUCCUAACCUAAAAUAAAAUAGAACAUACUGUGCUUAAAGCAAGGGGGGAAUCAUGUAACAAUAAAACCAGUGAAGAAAAUUCUAAUGCUCAGGUAAGGCCUCAGAAAAAGUGGAAAACAGCUGGUCCUCAGGAUCCUCCAGCCUUUGCCAAGGAAAAGUGGUUUUAAUCACUGAAGAAUGAGGCUUCAACAUAUGGAAAGACUGUAAGUGUCUUGACACUGAAAUUUUCUCUUGUAGGUGUUCCUGGACAGCAAGUGAGUGACUUGCUCACAGGCGGUAAUUCAGGGACCCAGGUUUCUUCUACCUGGUAGCUCUACUGUCCUUCAGAACCUCAGAGCCCUGUGCAUUCAGCCAGCAGGAGAAAGACCACUACUAAGGUCAUUCACUUUGGGAGAAGCCAGUCUUCAUGCCAUGAGGACGUUCAGGCAGCCCUGUGGAGAGAACCACAUGGAAAGGAUCUGAGGUCUCUCACCAGCACCAAUUUGCCAGCUAUGGGAAUGGGCCACCUUGGAAGGAGACUGUCCAGCCCAAGUGAAGGCUGCAGAUAACUGCAGCUUUGGCCAACAUUUGGCUAUAUUGCUUUGGGAAAUCUCAAGCCAGAACCAUCUGGCCAAGCUGCUCUUAAAUUCCUGAUC

Taxonomic tree

View annotations in different species by clicking on species names.

Scroll around to explore the entire tree. Click tree nodes to collapse or expand them. Hover over taxon names to display additional information.

Publications